silico.biotoul.fr
 

Enseignements

From silico.biotoul.fr

(Difference between revisions)
Jump to: navigation, search
m (Emploi du temps 2019-20)
 
(529 intermediate revisions not shown)
Line 1: Line 1:
 +
<!-- = Contrôles terminaux en distanciel 2020 =
 +
 +
'''Bioinformatique pour la génomique M1 Bioinfo CT session 2 2 juillet 10h-12h30''' : [[Media:CT_session2_BG_M1Bioinfo_juillet_2020.docx|sujet CT Biooinformatique pour la Génomique]] -->
 +
= Licence 2 et 3 Biologie  =
= Licence 2 et 3 Biologie  =
-
=== Bioinformatique - 2B2M (EDSVB4IM), BCP (EDSVA4HM), BOPE (L2 EDSVC4MM, L3 ELSVC6JM) ===
+
=== Bioinformatique - Option L2-L3 2B2M-BCP-BOPE ===
-
===='''Emploi du temps 2016-17'''====
+
UE en option avec différents codes :
 +
* L2 2B2M : EDSVB4IM
 +
* L2 BCP : EDSVA4HM
 +
* L2 BOPE : EDSVC4MM
 +
* L3 BOPE : ELSVC6JM
 +
 
 +
* Moodle : [https://moodle.univ-tlse3.fr/course/view.php?id=2518 EDSVB4IM]
 +
 
 +
===='''Emploi du temps 2019-20'''====
Aussi disponible sur https://calendar.google.com/calendar/embed?src=lic.bioinfo%40gmail.com&ctz=Europe/Paris
Aussi disponible sur https://calendar.google.com/calendar/embed?src=lic.bioinfo%40gmail.com&ctz=Europe/Paris
 +
 +
<html>
 +
<iframe src="https://calendar.google.com/calendar/embed?showTitle=0&amp;showCalendars=0&amp;mode=AGENDA&amp;height=400&amp;wkst=2&amp;hl=fr&amp;bgcolor=%23FFFFFF&amp;src=lic.bioinfo%40gmail.com&amp;color=%232952A3&amp;ctz=Europe%2FParis" style="border-width:0" width="550" height="400" frameborder="0" scrolling="no"></iframe>
 +
</html>
 +
 +
 +
 +
<big><big>'''Les groupes de TD et TP 2019-20 sont disponibles sur moodle : [https://moodle.univ-tlse3.fr/course/view.php?id=2518 https://moodle.univ-tlse3.fr/course/view.php?id=2518]'''</big></big>
 +
{| class="wikitable"
{| class="wikitable"
-
!colspan="4"|EDT L2 AADB
+
!colspan="4"|EDT L2-L3 2B2M-BCP-BOPE Bioinformatique
|-
|-
-
|                      || CM                                         || TD        ||  TP
+
|                      || CM                                                 || TD        ||  TP
|-
|-
-
| semaine 04 - 23.01  || 13h30-15h30 U2-Vandel RB Bioinfo générale ||
+
| semaine 03 - 18/01  || 13h45-15h45 R. Barriot  Bioinfo générale (lien zoom sur moodle)<br/> 16h00-18h00 F. Delavoie Imagerie         
 +
||
 +
||
|-
|-
-
| semaine 05 - 30.01  || 13h30-15h30 U1-Mathis FD Imagerie          ||          || 15h45-17h45 <br/> groupes 1 & 2 en 4TP2-M6 et M7 <br/> groupes 3 & 4 en U2-209
+
| semaine 04 - 25/01   
 +
||                    
 +
||           
 +
|| 13h45-15h05 groupe TP1a en U1-205 et TP1b en U1-206<br/>
 +
15h15-16h35 groupe TP2c en U1-205 et TP2d en U1-206<br/>
 +
16h45-18h05 groupe TP3e en U1-205 et TP3f en U1-206
|-
|-
-
| semaine 06 - 06.02  || 13h30-15h30 U1-Mathis RB BdD              || 15h45-17h45<br/> groupes 1 & 2 en U2-119<br/> groupes 3 & 4 en Algeco 03 ||
+
| semaine 05 - 01/02  || 13h45-15h45 R. Barriot  Bases de Données           
 +
|| 15h55-17h55 groupe TD1<br/>
 +
18h05-20h05 groupe TD2
 +
||
|-
|-
-
| semaine 08 - 20.02  ||                                           ||          || 13h30-15h30 groupes 1 & 2 en 4TP2-M6 4TP2-M7 <br/> 15h45-17h45 groupes 3 & 4 en 4TP2-M6 4TP2-M7
+
| semaine 06 - 08/02  ||                                                    
 +
||           
 +
|| 13h45-15h05 groupe TP1a en 4TP2-M6 et TP1b en 4TP2-M7<br/>  
 +
15h15-16h35 groupe TP2c en 4TP2-M6 et TP2d en 4TP2-M7<br/>
 +
16h45-18h05 groupe TP3e en 4TP2-M6 et TP2f en 4TP2-M7
|-
|-
-
| semaine 09 - 27.02  || 13h30-15h30 U1-Mathis MB                  ||          || 15h45-17h45 <br/> groupes 1 & 2 en 4TP2-M6 4TP2-M7 <br/> groupe 3 : 4TP4-P1 <br/>  groupe 4 : 4TP4-P15
+
| semaine 07 - 15/02  || 13h45-15h45 M. Bonhomme                                                   
 +
||           
 +
|| 15h55-17h55 2 groupes TP à 20 étudiant·e·s à distance<br/>18h05-20h05 1 groupe TP à 10 étudiant·e·s en présentiel en 4TP4-P15
|-
|-
-
| semaine 10 - 06.03   || '''13h30-15h30 Contrôle continu en U4-Turing'''              ||          ||
+
| semaine 08 - 22/02   ||                                                    
 +
||           
 +
||  
|-
|-
-
| semaine 11 - 13.03  || U2-Vandel GF/RB                            ||          || 15h45-17h45 <br/> groupes 1 & 2 en 4TP2-M6 4TP2-M7 <br/> groupe 3 : 4TP4-P1 <br/> groupe 4 : 4TP4-P15
+
| semaine 09 - 01/03  || '''13h45-15h15 Contrôle avec report en 4A-Molliard''' <br/>
 +
17h00-19h00 CM Banques de données et services bioinformatiques en ligne
 +
||           
 +
||
 +
|-  
 +
| semaine 10 - 08/03  ||                                         
 +
||         
 +
||  13h45-15h05 groupe TP1a en 4TP4-P1 et TP1b en 4TP4-P15<br/>
 +
15h15-16h35 groupe TP2c en 4TP4-P1 et TP2d en 4TP4-P15<br/>
 +
16h45-18h05 groupe TP3e en 4TP4-P1 et TP3f en 4TP4-P15
 +
|- 
 +
| semaine 11 - 15/03  ||                   
 +
||  13h45-15h55 groupe TD1 <br/>
 +
16h05-18h10 groupe TD2
 +
||
|-
|-
-
| semaine 12 - 20.03  ||                                            || 13h30-15h30 groupes 3 & 4 en U2-118 <br/> 15h45-17h45 groupes 1 & 2 en U2-119 ||  
+
| semaine 12 - 16/03  ||                                             
 +
||
 +
||  
|-
|-
-
| semaine 13 - 27.03  ||                                            ||          || '''<span style='color: #F00'>13h Consultation des copies en 4TP2-M6</span>''' <br/>13h30-15h30 groupes 1 & 2 en 4TP2-M6 4TP2-M7 <br/> 15h45-17h45 groupes 3 & 4 en 4TP2-M6 4TP2-M7
+
| semaine 13 - 23/03  ||                                             
 +
||           
 +
||  
|-
|-
-
| semaine 14 - 03.04  || '''13h30-15h30 Amphi Molliard - Contrôle terminal anticipé'''   ||          ||  
+
| semaine 14 - 30/03   ||
 +
||         
 +
||
 +
|-
 +
| semaine 15 - 12/04  || '''13h45-15h15 Contrôle terminal anticipé en 4A-Molliard'''                                                    
 +
||           
 +
||
|}
|}
-
'''Groupes de TP'''
+
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
<!--
 +
|-
 +
| semaine 20 - 15.05  ||                                            ||          || '''<span style='color: #F00'>12h-13h Consultation des copies en 4TP4-P15</span>'''
 +
 
 +
'''Groupes de TD'''
{| style="border-collapse: separate; border-spacing: 0; border-width: 1px; border-style: solid; border-color: #aabbcc; padding: 3px; width: 100%; background-color: #bbccdd; text-align: center;"
{| style="border-collapse: separate; border-spacing: 0; border-width: 1px; border-style: solid; border-color: #aabbcc; padding: 3px; width: 100%; background-color: #bbccdd; text-align: center;"
-
!colspan="5"|Groupes de TP
+
!colspan="3"|Groupes de TD
|- style="background-color: #ddeeff;"
|- style="background-color: #ddeeff;"
| style="padding-left: 0.5em; border-width: 1px; border-style: solid;" | Groupe 1  
| style="padding-left: 0.5em; border-width: 1px; border-style: solid;" | Groupe 1  
| style="padding-left: 0.5em; border-width: 1px; border-style: solid;" | Groupe 2  
| style="padding-left: 0.5em; border-width: 1px; border-style: solid;" | Groupe 2  
-
| style="padding-left: 0.5em; border-width: 1px; border-style: solid;" | Groupe 3
 
-
| style="padding-left: 0.5em; border-width: 1px; border-style: solid;" | Groupe 4
 
|- style="background-color: #ddeeff;"
|- style="background-color: #ddeeff;"
| style="padding-left: 0.5em; border-width: 1px; border-style: solid;" |  
| style="padding-left: 0.5em; border-width: 1px; border-style: solid;" |  
-
AVERSO JULIEN <br/>
 
-
BERLIN TRISTAN <br/>
 
-
BOULLIAT VINCENT <br/>
 
-
CERRUTI CLOE <br/>
 
-
COLIN ALEXANDRE <br/>
 
-
DAUPHIN BASTIEN <br/>
 
-
DELERIS KILIAN <br/>
 
-
FERNANDEZ MAXIMILIEN <br/>
 
-
FOURCAUD GUSTAVE <br/>
 
-
JMEL BOYER INES <br/>
 
-
LEBRUN TANGUY <br/>
 
-
LEFEVRE PAUL <br/>
 
-
RALAHY MAEVA <br/>
 
-
STUTZ MANON <br/>
 
-
TRUFFET ARTHUR <br/>
 
-
 
-
| style="padding-left: 0.5em; border-width: 1px; border-style: solid;" |
 
-
BENHAMA LYDIA <br/>
 
-
BISSANE YOUSSEF <br/>
 
-
BOUILLAUD CLEMENTINE <br/>
 
-
CLEDASSOU VALENTIN <br/>
 
-
COPPEAUX ELOISE <br/>
 
-
DUPUYAU ROSELINE <br/>
 
-
FERHAH MANEL <br/>
 
-
FOURCADE MARIE <br/>
 
-
GAYET CEDRIC <br/>
 
-
HMILA IMEN <br/>
 
-
HOORELBECK - BROUQUI MARGAUX <br/>
 
-
MIRANDA-CAPET ROMAIN <br/>
 
-
NGUYEN HAI LINH <br/>
 
-
TARAYRE GABRIEL <br/>
 
-
VELPRAT LOIC <br/>
 
 +
L2 BCP<br/>
 +
et<br/>
 +
L2 2B2M (Nom de famille commençant par : A jusqu'à G inclus)
| style="padding-left: 0.5em; border-width: 1px; border-style: solid;" |  
| style="padding-left: 0.5em; border-width: 1px; border-style: solid;" |  
-
AMO TEIHOARII <br/>
 
-
BONOTTO ELISE <br/>
 
-
CANUT BENJAMIN <br/>
 
-
COOKE JULIETTE <br/>
 
-
COSSOU MATTHIAS <br/>
 
-
DASSIEU CECILE <br/>
 
-
DURAND GAETAN <br/>
 
-
KHALED MERIEM <br/>
 
-
KHELIFI FATMA <br/>
 
-
LACOSTE Pierre <br/>
 
-
LAJAT AMANDINE <br/>
 
-
LANDURE BRICE <br/>
 
-
LORVELLEC MARIE <br/>
 
-
PERRIER MARION <br/>
 
-
SUIRE PAUL <br/>
 
-
 
+
L2/L3 BOPE<br/>
-
| style="padding-left: 0.5em; border-width: 1px; border-style: solid;" |
+
et
-
ALBERT HEVIA FABIO <br/>
+
<br/>
-
BERNES - LASSERRE PASCALE <br/>
+
L2 2B2M (Nom de famille commençant par : K à Z)
-
CHATELAIS MYLENE <br/>
+
-
DESCOMBE THOMAS <br/>
+
-
FLANER PRISCILLA <br/>
+
-
FOUGERON BAPTISTE <br/>
+
-
GENAIS MATTHIEU <br/>
+
-
INVERNIZZI MARIE <br/>
+
-
MAMODE ANTHONY <br/>
+
-
MARCHARD LAURA <br/>
+
-
PIPPO QUENTIN <br/>
+
-
RANTY SARAH <br/>
+
-
TEULIER MARIELLE <br/>
+
-
VAILLE MELANIE <br/>
+
-
VERA LEANDRO <br/>
+
|}
|}
 +
-->
===='''Supports de cours'''====
===='''Supports de cours'''====
Line 119: Line 134:
* CM3 [[Media:LBioinfo.systemes.d.information.pdf|Introduction aux bases de données]]
* CM3 [[Media:LBioinfo.systemes.d.information.pdf|Introduction aux bases de données]]
* CM4 [[Media:LBioinfo_Genetics_bis.pdf|Utilisation de l'information génétique en biologie]]
* CM4 [[Media:LBioinfo_Genetics_bis.pdf|Utilisation de l'information génétique en biologie]]
-
* CM5 [[Media:Intro_BioSyst_L2.pdf|Introduction à la biologie des système : initiation à la modélisation de réseaux de gènes]]
+
* CM5 [[Media:Intro_BioSyst_L2_2019.pdf|Introduction à la biologie des système : initiation à la modélisation de réseaux de gènes]]
===='''Sujets de TD/TP'''====
===='''Sujets de TD/TP'''====
* [[L2-L3 Bioinfo - TP Traitement d'images|TP1]] Traitement d'images
* [[L2-L3 Bioinfo - TP Traitement d'images|TP1]] Traitement d'images
-
* [[L2-L3 Bioinfo - TD Bases de donnees - correction|TD1]] Bases de données
+
* [[L2-L3 Bioinfo - TD Bases de donnees|TD1]] Bases de données
* [[L2-L3 Bioinfo - TP Bases de donnees|TP2]] Bases de données
* [[L2-L3 Bioinfo - TP Bases de donnees|TP2]] Bases de données
* [[L2-L3 Bioinfo - TP Analyses statistiques des données (phénotypes,génotypes)|TP3]] Analyses statistiques des données (phénotypes,génotypes)
* [[L2-L3 Bioinfo - TP Analyses statistiques des données (phénotypes,génotypes)|TP3]] Analyses statistiques des données (phénotypes,génotypes)
Line 129: Line 144:
* [[Media:L2-L3 Bioinfo - TD Transcriptomique.pdf|TD2]] Transcriptomique
* [[Media:L2-L3 Bioinfo - TD Transcriptomique.pdf|TD2]] Transcriptomique
* [[Media:TP_modelisation_regulation_fls2.pdf|TP5 Modélisation d'un réseau de régulation]]
* [[Media:TP_modelisation_regulation_fls2.pdf|TP5 Modélisation d'un réseau de régulation]]
-
* [[Media:TP_regulation_fls2.pdf|correction du TP5 Modélisation d'un réseau de régulation]]
+
** [[Media:snoopy.7z|archive installation de snoopy]]
 +
** [[Media:fls2_regulation_simplifie.spn|réseau de Petri stochastique pour la régulation de fls2]]
 +
** [[Media:TP_regulation_fls2.pdf|correction du TP5 Modélisation d'un réseau de régulation]]
-
* [[Media:snoopy.7z|archive installation de snoopy]]
+
= BioAnalyse L3 BCP =
-
<!-- * [[Media:fls2_regulation_simplifie.spn|réseau de Petri stochastique pour la régulation de fls2]] -->
+
-
=== BioAnalyse L3 BCP ===
+
==='''2020_2021 Planning des Enseignements L3 BCP et répartition en séries de TPs (semestre 6 (ELSV6CM1))'''===
 +
Toutes les informations relatives à l'UE de Bioanalyse sont également disponibles dans l'espace dédié sur Moodle
 +
* [[Media:2021-Planning_Bionalyse_L3 BCP_avec salles.pdf|2021 Planning Bioanalyse L3 BCP (semaine rouge/bleue)]]
 +
* [[Media:2021_GroupesTPs.pdf|2021 Séries de TP Bioanalyse (rouge/bleue) L3 BCP]]
 +
* [[Media:2021_Liens Zoom CMs Bioanalyse.pdf|2021 Liens Zoom pour CMs en distanciel de l'UE]]
 +
* [[Media:2021_Presentation de l'UE_OK.pdf|2021 Présentation de l'UE]]
-
===='''Planning des Enseignements L3 BCP semestre 6 (ELSV6CM1)'''====
+
<!--
-
* [[Media:1617Planning Bionalyse L3 BCP.pdf|Planning L3 BCP 2016_2017]]
+
* [[Media:1920_Bioanalyse_planning.pdf|Planning Bioanalyse L3 BCP 2019_2020]]
 +
* [[Media:presentation_UE_bioanalyse_2020.pdf|Présentation de l'UE]]
 +
* [[Media:1819_Planning TPS CMs.pdf|Planning Bioanalyse L3 BCP 2018_2019]]
 +
* [[Media:presentation_UE_bioanalyse_2019.pdf|Présentation de l'UE]]
-
===='''Cours'''====
+
-->
-
* CM1 : [[Media:Introduction_bioinfo_2017.pdf|Introduction à la bioinformatique]]
+
 
-
* CM2 : [[Media:banque_2017.pdf|Introduction aux banques de données]]
+
<!--===='''Vidéos des Cours'''====
 +
* CM1 : [http://silico.biotoul.fr/enseignement/L3-Biologie/Videos_Cours_L3BCP_Bionalyse_2021/Introduction_Bioinfo.mp4 Introduction à la bioinformatique]
 +
* CM1 : [[Media:Introduction_bioinfo_2020_modified.pdf|Introduction à la bioinformatique]]
 +
* CM2 : [[Media:banque_2020.pdf|Introduction aux banques de données]]
* CM3 : [[Media:Alignement_seq_nuc.pdf|Alignement de deux séquences d'acides nucléiques]]
* CM3 : [[Media:Alignement_seq_nuc.pdf|Alignement de deux séquences d'acides nucléiques]]
* CM4 : [[Media:Alignement_seq_prot_2015.pdf|Alignement de deux séquences protéiques : les matrices de substitution]]
* CM4 : [[Media:Alignement_seq_prot_2015.pdf|Alignement de deux séquences protéiques : les matrices de substitution]]
-
* CM5 : [[Media:Blast_2016.pdf|Recherche par similarité dans les bases de données]]
+
* CM5 : [[Media:Blast_2020.pdf|Recherche par similarité dans les bases de données]]
* CM6 : [[Media:AlignementMultiple_2017.pdf|Alignement multiple]]
* CM6 : [[Media:AlignementMultiple_2017.pdf|Alignement multiple]]
* CM6 : [[Media:motif_profil_2017.pdf|Motif et domaine fonctionnels]]
* CM6 : [[Media:motif_profil_2017.pdf|Motif et domaine fonctionnels]]
 +
-->
-
===='''TPs'''====
+
===='''Videos des Cours'''====
 +
* CM1 : [http://silico.biotoul.fr/enseignement/L3-Biologie/Videos_Cours_L3BCP_Bionalyse_2021/Introduction_Bioinfo.mp4 Introduction à la bioinformatique]
 +
* CM2 : [http://silico.biotoul.fr/enseignement/L3-Biologie/Videos_Cours_L3BCP_Bionalyse_2021/bases_donnees.mp4 Introduction aux banques de données]
 +
* CM2 : [http://silico.biotoul.fr/enseignement/L3-Biologie/Videos_Cours_L3BCP_Bionalyse_2021/erratum_bases_donnees.mp4 petit erratum Introduction aux banques de données]
 +
* CM3 : [http://silico.biotoul.fr/enseignement/L3-Biologie/Videos_Cours_L3BCP_Bionalyse_2021/Comparaison_deux_sequences_partie1.mp4 Comparaison de deux séquences-partie_1]
 +
* CM4 : [http://silico.biotoul.fr/enseignement/L3-Biologie/Videos_Cours_L3BCP_Bionalyse_2021/comparaison_deux_sequences_partie2.mp4 Comparaison de deux séquences-partie_2]
 +
* CM5 : [http://silico.biotoul.fr/enseignement/L3-Biologie/Videos_Cours_L3BCP_Bionalyse_2021/recherche_similarite_avec_Blast.mp4 Recherche par similarité dans les bases de données]
 +
* CM5 : [http://silico.biotoul.fr/enseignement/L3-Biologie/Videos_Cours_L3BCP_Bionalyse_2021/Alignement_multiple.mp4 Alignement multiple]
 +
* CM6 : [http://silico.biotoul.fr/enseignement/L3-Biologie/Videos_Cours_L3BCP_Bionalyse_2021/Motifs_domaines_fonctionnels.mp4 Motifs et domaines fonctionnels]
 +
 
 +
===='''Cours'''====
 +
* CM1 : [[Media:Introduction_bioinfo_2020_modified.pdf|Introduction à la bioinformatique]]
 +
* CM2 : [[Media:banque_2020.pdf|Introduction aux banques de données]]
 +
* CM3 : [[Media:Alignement_seq_nuc.pdf|Alignement de deux séquences d'acides nucléiques]]
 +
* CM4 : [[Media:Alignement_seq_prot_2021.pdf|Alignement de deux séquences protéiques]]
 +
* CM5 : [[Media:Blast_2021.pdf|Recherche par similarité dans les bases de données]]
 +
* CM5 : [[Media:AlignementMultiple_2021.pdf|Alignement multiple]]
 +
* CM6 : [[Media:motif_profil_2021.pdf|Motifs et domaines fonctionnels]]
 +
 
 +
===='''TPs, année 2020_2021'''====
 +
 
 +
 
 +
* TP1 : [[TP1_Bioanalyse|Interrogation des banques de données et Analyses de Séquences]]
 +
* TP2 : [[TD2_Bioanalyse|Alignement par paires]]
 +
* TP3 : [[TD3_Bioanalyse21|Blast, Alignement multiple et Signatures]]
 +
 
 +
===='''TPs, versions antérieures à 2020_2021'''====
* TP1 : [[TD1_Bioanalyse|Interrogation des banques de données]]
* TP1 : [[TD1_Bioanalyse|Interrogation des banques de données]]
Line 157: Line 211:
* TP5 : [[TD5_Bioanalyse|Revisions]]
* TP5 : [[TD5_Bioanalyse|Revisions]]
-
===='''Exemples de contrôle continue corrigé'''====
+
===='''Exemples de contrôle continu corrigé'''====
* CC 2014 : [[Media:Correction_sujet_CC_L3Biologie_EL6BIOFM_2014.pdf|Questions + corrections]]
* CC 2014 : [[Media:Correction_sujet_CC_L3Biologie_EL6BIOFM_2014.pdf|Questions + corrections]]
* CC 2014 : [[Media:correction_alignement_CC_2013.pdf|correction de la construction de la matrice de programmation dynamique]]
* CC 2014 : [[Media:correction_alignement_CC_2013.pdf|correction de la construction de la matrice de programmation dynamique]]
-
* CC 2013 : [[Media:Correction_sujet_CC_L3Biologie_EL6BIOFM.pdf|Questions + corrections]]
+
<!-- * CC 2013 : [[Media:Correction_sujet_CC_L3Biologie_EL6BIOFM.pdf|Questions + corrections]]
 +
* CC 2017 : [[Media:sujet_CC_Bioanalyse_L3BCP_2017_correction.pdf|Correction du contrôle continu 2017]] -->
 +
 
 +
= BioAnalyse L3 2B2M =
 +
 
 +
===='''TPs'''====
 +
 
 +
* TP1 : [[TD1_Bioanalyse|Interrogation des banques de données]]
 +
* TP2 : [[TD2_Bioanalyse|Alignement par paires]]
 +
* TP3 : [[Bioanalyse_TD_Analyse_de_sequences_et_Biologie_Moleculaire|Analyse de séquences et biologie Moléculaire]]
 +
* TP4 : [[TD4_Bioanalyse|BLAST, alignement multiple, signature protéique]]
 +
* TP5 : [[TD5_Bioanalyse|Revisions]]
= Licence 3 Biologie des Organismes des populations et Ecosystemes (BOPE)  =
= Licence 3 Biologie des Organismes des populations et Ecosystemes (BOPE)  =
=== Du génome à la sélection des plantes (ELSVC5EM) ===
=== Du génome à la sélection des plantes (ELSVC5EM) ===
 +
<!--
 +
TP pour une seance unique de 4h
* TP : [[TP Initiation Bioanalyse |Initiation Bioanalyse]]
* TP : [[TP Initiation Bioanalyse |Initiation Bioanalyse]]
 +
-->
 +
Initiation à la 'Bioanalyse'
 +
* TP : [[TD1_Genome Selection Plantes|Interrogation des banques de données et recherche par similarité]]
 +
<!--
<!--
-
* TP1 : [[TD1_Genome Selection Plantes|Interrogation des banques de données et recherche par similarité]]
 
* TP2 : [[TD2_Genome Selection Plantes|Alignement multiples et signatures proteiques]]
* TP2 : [[TD2_Genome Selection Plantes|Alignement multiples et signatures proteiques]]
 +
==== Harmonisation des Connaissances, partie Bioanalyse (EMBIA1IM) ====
 +
* Supports de cours
 +
http://www.mabs.ups-tlse.fr/index.php/Ressources_pedagogique#Bioanalyse_.28EM7BMGD2.29
 +
* TD1 : [[Interrogation des banques de données]]
 +
* TD2 : [[Analyse de séquences I: recherche par similarité, alignements deux à deux]]
 +
* TD3 : [[Analyse de séquences II: alignements multiples et profils]]|
 +
-->
 +
 +
<!--
== Licence 3 ==
== Licence 3 ==
Line 250: Line 329:
'''Supports de cours :'''
'''Supports de cours :'''
-
* [[Media:M1 Traitement de Donnees Biologiques - Statistiques et Analyses Multivariees.pdf|Statistiques et Analyses Multivariées - M. Bonhomme]]
+
* [[Media:M1 Traitement de Donnees Biologiques - Statistiques et Analyses Multivariees.pdf|Statistiques - M. Bonhomme]]
* [[Media:Transcriptome.pdf|Transcriptome - R. Barriot]]
* [[Media:Transcriptome.pdf|Transcriptome - R. Barriot]]
Line 270: Line 349:
-->
-->
 +
<!--
 +
 +
 +
 +
<big>'''Contrôle continu'''</big>
 +
* Contrôle continu 2019-20 : [[silico:enseignement/m1/tdb/CC2019/|Sujet et fichiers à utiliser]]
 +
 +
 +
<big>'''Contrôle continu'''</big>
 +
* Contrôle continu 2018-19 : [[silico:enseignement/m1/tdb/CC2018/|Sujet et fichiers à utiliser]]
 +
 +
<big>'''Contrôle continu'''</big>
 +
* Contrôle continu 2017-18 : [[silico:enseignement/m1/tdb/CC2017/|Sujet et fichiers à utiliser]]
 +
-->
 +
 +
<!--
'''Contrôle continu'''
'''Contrôle continu'''
* Contrôle continu 2016 : [[silico:enseignement/m1/tdb/cc2016.html|Sujet et fichiers à utiliser]]
* Contrôle continu 2016 : [[silico:enseignement/m1/tdb/cc2016.html|Sujet et fichiers à utiliser]]
 +
-->
 +
* Archives
* Archives
** Contrôle continu de 2011 avec son corrigé [[Media:M1 MABS Traitement de Donnees Biologiques - CC 2011 et correction.zip|CC 2011 et correction.zip]]
** Contrôle continu de 2011 avec son corrigé [[Media:M1 MABS Traitement de Donnees Biologiques - CC 2011 et correction.zip|CC 2011 et correction.zip]]
Line 285: Line 382:
** RStudio : https://www.rstudio.com
** RStudio : https://www.rstudio.com
** https://www.datacamp.com Apprendre R en ligne
** https://www.datacamp.com Apprendre R en ligne
 +
** https://rdrr.io/snippets/ Utilisation de R depuis un navigateur
 +
<!-- deprecated
** http://tryr.codeschool.com/levels/1/challenges/1 Apprendre en ligne aussi
** http://tryr.codeschool.com/levels/1/challenges/1 Apprendre en ligne aussi
** http://www.r-fiddle.org Utilisation de R depuis un navigateur
** http://www.r-fiddle.org Utilisation de R depuis un navigateur
 +
-->
==== Génétique Evolutive et Quantitative (EMBIA1GM) ====
==== Génétique Evolutive et Quantitative (EMBIA1GM) ====
'''Support de cours:'''
'''Support de cours:'''
-
* [[Media: GEQ_presentation.pdf|présentation de GEQ - M. Bonhomme]]
+
* [[Media: GEQ_presentation1.pdf|présentation de GEQ - M. Bonhomme]]
* [[Media: GEQ_intro.pdf|introduction à GEQ - M. Bonhomme]]
* [[Media: GEQ_intro.pdf|introduction à GEQ - M. Bonhomme]]
-
* [[Media: GEQ_pop_gen.pdf|GE - Génétique des populations - M. Bonhomme]]
+
* [[Media: GEQ_pgen.pdf|GE - Génétique des populations - M. Bonhomme]]
-
* [[Media: Genetique-quantitative.pdf|GQ - Génétique-quantitative - C. Robert-Granié]]
+
* [[Media: CM_Genetique_Quantitative_2020bis.pdf|GQ - Génétique-Quantitative - M. Bonhomme]]
-
* [[Media: Genetique-quantitative-Parente.pdf|GQ - Génétique-quantitative-apparentement - C. Robert-Granié]]
+
* [[Media: Carto_Génétique_2019.pdf|GQ - Cartographie génétique - M. Bonhomme]]
-
* [[Media: Carto_Marqueurs.pdf|GQ - Cartographie de marqueurs moléculaires - B. Mangin]]
+
-
* [[Media: Carto_QTL.pdf|GQ - Cartographie de Quantitative Tait Loci - B. Mangin]]
+
-
* [[Media: Asso-QTL.pdf|GQ - Génétique d'association - B. Mangin]]
+
'''Supports de TD/TP :'''
'''Supports de TD/TP :'''
-
* [[Media: TD1_GEQ_pop_gen.pdf|TD1 génétique des populations]]
+
* [[Media: TD1_GEQ_pgen.pdf|TD1 génétique des populations]]
-
* [[Media: TP1_genetic_diversity_drift.zip|TP1 génétique des populations]]
+
* [[Media: TP1_population_genetics_2020.zip|TP1 génétique des populations]]
-
* [[Media: TD-Génétique Statistique-2016.pdf|TD2 génétique quantitative liaison/association]]
+
* [[Media: TD-Génétique_Quantitative_2019.pdf|TD2 génétique quantitative]]
-
* [[Media: TP2-parente-moleculaire.zip|TP2 génétique quantitative parenté moléculaire]]
+
* [[Media: TP2_heritability_2020.zip|TP2 génétique quantitative]]
-
* [[Media: TD-backcross.pdf|TD3 génétique quantitative liaison/association]]
+
* [[Media: TD3_carto_génétique_2019.pdf|TD3 cartographie génétique]]
-
* [[Media: TP2-measureLD.zip|TP3 génétique quantitative mesures DL]]
+
=== Master 1 - Bioinformatique et Biologie des Systèmes + Biotechnologies ===
=== Master 1 - Bioinformatique et Biologie des Systèmes + Biotechnologies ===
Line 311: Line 407:
'''Supports de cours :'''
'''Supports de cours :'''
-
* [[Media:CM1_EM_intro.pdf|Introduction à l'évolution moléculaire]]
+
* [[Media:cours_EM_intro_2021.pdf|Introduction à l'évolution moléculaire]]
-
* [[Media:Phylogenie_Definitions_2015.pdf|Evolution moléculaire : définitions]]
+
* [[Media:Phylogenie_Definitions_2019.pdf|Evolution moléculaire : définitions]]
-
* [[Media:Phylogenie_Modeles_Evolutifs_2015.pdf|Modèles évolutifs]]
+
* [[Media:Phylogenie_Modeles_Evolutifs_2019.pdf|Modèles évolutifs]]
-
* [[Media:Phylogenie_Methodes_2014.pdf|Méthodes de reconstructions phylogénétiques ]]
+
* [[Media:Phylogenie_Methodes_2019.pdf|Méthodes de reconstructions phylogénétiques ]]
* [[Media:Phylogenie_Methodes_part2_2014.pdf|Méthodes de reconstructions phylogénétiques (suite)]]
* [[Media:Phylogenie_Methodes_part2_2014.pdf|Méthodes de reconstructions phylogénétiques (suite)]]
-
* [[Media:CM6_EM_adapt_mol.pdf|Adaptation moléculaire]]
+
* [[Media:cours_EM_adapt_mol_2021.pdf|Adaptation moléculaire]]
'''Support TP : '''
'''Support TP : '''
* [[silico:enseignement/m1-mabs/EvolMol/TD1/index.html|tutorial TP1 et TP2]]
* [[silico:enseignement/m1-mabs/EvolMol/TD1/index.html|tutorial TP1 et TP2]]
-
* [[Media:Introduction_competence_2017.pdf|Petit topo d'introduction sur la régulation de la compétence chez ''S. pneumoniae'']]
+
* [[Media:Introduction_competence_2020.pdf|Petit topo d'introduction sur la régulation de la compétence chez ''S. pneumoniae'']]
-
* [[Media:Correction_TP1_TP2_2017_new.pdf|Correction des TP1 et TP2]]
+
<!-- * [[Media:Correction_TP1_TP2_2018.pdf|Correction des TP1 et TP2]] -->
-
* [[Media:questions_reponses_ComD_ComE_trees.pdf|Correction du questionnaire sur l'analyse des arbres ComE et COmD]]
+
* [[Media:questions_reponses_ComD_ComE_trees_srep_2019.pdf|Questionnaire sur l'analyse des arbres ComE et ComD]]
 +
<!-- * [[Media:questions_reponses_ComD_ComE_trees_2020.pdf|Correction du questionnaire sur l'analyse des arbres ComE et ComD]] -->
* [[Media:TP3_adaptation_moleculaire.zip|tutorial TP3]]
* [[Media:TP3_adaptation_moleculaire.zip|tutorial TP3]]
 +
* [[Media:TP3_adaptation_moleculaire_2019_2020.zip|tutorial TP3_2019_2020]]
'''Support TD : '''
'''Support TD : '''
Line 330: Line 428:
* [[Media:TD1_Evolution_Moleculaire.pdf|TD1 ]]
* [[Media:TD1_Evolution_Moleculaire.pdf|TD1 ]]
* [[Media:TD2_EMBAIE_M1_Bioinfo_M1_Biotech.pdf|TD2 exemple de Contrôle continu ]]
* [[Media:TD2_EMBAIE_M1_Bioinfo_M1_Biotech.pdf|TD2 exemple de Contrôle continu ]]
 +
<!-- * [[Media:Correction_TD2_Evolution_Moleculaire_2020.pdf|Correction du TD2 ]]-->
* [[Media:TD3 Evolution Moléculaire.pdf|TD3 Adaptation moléculaire ]]
* [[Media:TD3 Evolution Moléculaire.pdf|TD3 Adaptation moléculaire ]]
-
'''Exemple CC corrigé : '''
+
<!--'''Exemple CC corrigé : '''
* [[Media:sujet_CC_complet.pdf|CC de 2011 ]]
* [[Media:sujet_CC_complet.pdf|CC de 2011 ]]
-
* [[Media:correction_CC_oct-2011.pdf|correction du CC de 2011 ]]
+
* [[Media:correction_CC_oct-2011.pdf|correction du CC de 2011 ]]-->
Line 349: Line 448:
=== Master 1 - Bioinformatique et Biologie des Systèmes ===
=== Master 1 - Bioinformatique et Biologie des Systèmes ===
 +
 +
* Diaporama réunion de rentrée [[Media:M1BBS.Accueil.Inscriptions.Pedagogiques.pdf]]
* [[Linux tips]]
* [[Linux tips]]
Line 355: Line 456:
==== Bioinformatique pour la Génomique (EMBIA1DM) ====
==== Bioinformatique pour la Génomique (EMBIA1DM) ====
'''Supports de cours :'''
'''Supports de cours :'''
-
* [[Media:Introduction_bio_annotation.pdf|Introduction biologique  (Gwennaele Fichant)]]
+
 
 +
* [[Media:Cours_Introduction_Jean_Phillipe_Galaud.pdf|Introduction génomique  (Jean-Philippe Galaud)]]
 +
* [[Media:Introduction_bio_annotation_2018.pdf|Introduction biologique  (Gwennaele Fichant)]]
* [[Media:Annotation1.pdf|Annotation partie 1 (Gwennaele Fichant)]]
* [[Media:Annotation1.pdf|Annotation partie 1 (Gwennaele Fichant)]]
-
* [[Media:Annotation2_v2_2016.pdf|Annotation partie 2 (Gwennaele Fichant)]]
+
* [[Media:annotation2_2020.pdf|Annotation partie 2 (Gwennaele Fichant)]]
-
* [[Media:motif_profil_2014.pdf|Définition et identification des motifs et profils dans les séquences (cours de L3 Bioanalyse) (Gwennaele Fichant)]]
+
* [[Media:motif_profil_2017.pdf|Définition et identification des motifs et profils dans les séquences (cours de L3 Bioanalyse) (Gwennaele Fichant)]]
-
* [[Media:HMM_2015.pdf|Modèle de Markov Caché (HMM) (Gwennaele Fichant)]]
+
* [[Media:HMM_2017.pdf|Modèle de Markov Caché (HMM) (Gwennaele Fichant)]]  
* [[Media:cours-align_genome.pdf|Introduction aux alignements de génomes bactériens (Gwennaele Fichant)]]
* [[Media:cours-align_genome.pdf|Introduction aux alignements de génomes bactériens (Gwennaele Fichant)]]
'''Tutoriels de TP :'''
'''Tutoriels de TP :'''
-
*[[silico:enseignement/m1-bioinfo/BG/TD_annotation/tutorial_annotation_new_NVU.html|Annotation d'un fragment génomique bactérien]]
+
*[[silico:enseignement/m1-bioinfo/BG/TD_annotation/Tutorial_annotation_v1_2019.html|Annotation d'un fragment génomique bactérien]]
-
*[[silico:enseignement/m1-bioinfo/BG/summary_SignalP.pdf|Petite explication de SignalP]]
+
<!--*[[silico:enseignement/m1-bioinfo/BG/summary_SignalP.pdf|Petite explication de SignalP]] -->
-
*[[silico:enseignement/m1-bioinfo/BG/TD_HMM/TD_HMM.html| design d'un HMM pour prédire les promoteurs sigma A de B. subtilis]]
+
*[[silico:enseignement/m1-bioinfo/BG/TD_HMM/TD_HMM_2017.html| design d'un HMM pour prédire les promoteurs sigma A de B. subtilis]]
-
*[[Media:Complement_TD_HMM.pdf|Complément d'information pour réaliser le TD de design du HMM ]]
+
**[[Media:SHOW.tar.gz|archive compressée de SHOW à télécharger]]
 +
**[[silico:enseignement/m1-bioinfo/BG/TD_HMM/seq.tar.gz|archive des séquences compressée]]
 +
<!-- *to download: [[silico:enseignement/m1-bioinfo/BG/TD_HMM/show_saba.tar.gz| show_saba.tar.gz]] -->
 +
<!--*[[Media:Complement_TD_HMM.pdf|Complément d'information pour réaliser le TD de design du HMM ]]-->
-
Aide pour la réalistion du projet annotation
+
Aide pour la réalisation du projet annotation
*[[silico:enseignement/m1-bioinfo/BG/TD_artemis/Annotation_artemis.html|Introduction à Artemis]]
*[[silico:enseignement/m1-bioinfo/BG/TD_artemis/Annotation_artemis.html|Introduction à Artemis]]
*[[silico:enseignement/m1-bioinfo/BG/memo_Perl.html|Petit guide de programmation en Perl]]
*[[silico:enseignement/m1-bioinfo/BG/memo_Perl.html|Petit guide de programmation en Perl]]
Line 374: Line 480:
'''Contrôle continu :'''  
'''Contrôle continu :'''  
-
* '''Rapport de TP''' sur le design d'un HMM à rendre au plus tard le '''lundi 14 novembre'''. M'envoyer pa courrier le rapport en format pdf ainsi que le fichier en format texte comportant votre modèle avant estimation des probabilités.
+
*'''Rapport de TP''' sur le design d'un HMM à rendre au plus tard le '''lundi 12 octobre'''. M'envoyer par courrier le rapport en format pdf ainsi que le fichier en format texte comportant votre modèle avant estimation des probabilités et celui après estimation des probabilités.
-
* '''Projet annotation''' d'un fragment génomique à remettre au plus tard '''le vendredi 9 décembre'''  
+
* '''Projet annotation''' d'un fragment génomique à remettre au plus tard '''le lundi 7 décembre'''  
-
** '''Description du travail à réaliser dans le fichier ci-joint : [[Media:Projet_2016.docx|description du projet]]
+
** '''Description du travail à réaliser dans le fichier ci-joint''' : [[Media:Projet_2019.docx|description du projet]]
 +
** '''Description du travail à réaliser pour les parsers dans le fichier ci-joint''' : [[Media:Description_parsers_2019.docx|description des parsers]]
** '''Annoter une des deux séquences fournies''' : [[Media:seq1-5404.txt|séquence 1]] ou [[Media:seq2-7490.txt|séquence 2]]
** '''Annoter une des deux séquences fournies''' : [[Media:seq1-5404.txt|séquence 1]] ou [[Media:seq2-7490.txt|séquence 2]]
** [[Media:exemple_annotation_EMBL.txt|Exemple d'annotation au format EMBL]]
** [[Media:exemple_annotation_EMBL.txt|Exemple d'annotation au format EMBL]]
Line 398: Line 505:
==== Mathématique pour la Biologie (EMBIA1EM) ====
==== Mathématique pour la Biologie (EMBIA1EM) ====
-
* [[Media:M1 MABS BBS Math Memento.pdf|Memento]] de Régine André-Obrecht
+
 
 +
'''Sujets de TP :'''
 +
 
* [[M1 MABS BBS Math TD Calcul Matriciel|TD]] Calcul matriciel
* [[M1 MABS BBS Math TD Calcul Matriciel|TD]] Calcul matriciel
* [[M1 BBS Math TD ACP|TD]] ACP
* [[M1 BBS Math TD ACP|TD]] ACP
Line 404: Line 513:
* [[M1 MABS BBS Math TD Proba|TD]] Probabilités
* [[M1 MABS BBS Math TD Proba|TD]] Probabilités
 +
<!--
 +
'''CCTP'''
 +
* Exam TP 2020-21 : [[silico:enseignement/m1/math/cc/|Sujet et fichiers à utiliser]]
 +
<big>'''Exam TP'''</big>
 +
* Exam TP 2018-19 : [[silico:enseignement/m1/math/cc/|Sujet et fichiers à utiliser]]
 +
-->
 +
'''Liens :'''
 +
* http://exercism.io : améliorer son niveau de programmation dans différents langages (notamment R)
 +
 +
'''Références'''
 +
* ''Mathématiques pour les Sciences de la vie et de la Terre'' – C. David, S. Mustapha, F. Viens, N. Capron, edition Dunod
 +
 +
'''Projet 2020-21 :'''
 +
* [[silico:enseignement/m1/math/projet/M1BBS_Math_Sujet_Projet_2020-21.html|Sujet du projet 2020-21]]
 +
<!-- * Choix d'un graphe pour le projet (ne pas prendre un graphe déjà choisi par quelqu'un d'autre) : https://framadate.org/M1BBS-Projet-Math -->
 +
* Les projets sont à rendre '''avant''' les fêtes de fin d'année
 +
* Graphe à analyser
 +
*# [[silico:enseignement/m1/math/projet/g1.gr|graphe 1]] Gabryelle
 +
*# [[silico:enseignement/m1/math/projet/g2.gr|graphe 2]] Marine
 +
*# [[silico:enseignement/m1/math/projet/g3.gr|graphe 3]] Etienne
 +
*# [[silico:enseignement/m1/math/projet/g4.gr|graphe 4]] Hugo
 +
*# [[silico:enseignement/m1/math/projet/g5.gr|graphe 5]] Lou
 +
*# [[silico:enseignement/m1/math/projet/g6.gr|graphe 6]] Victoria
 +
*# [[silico:enseignement/m1/math/projet/g7.gr|graphe 7]] Julien
 +
*# [[silico:enseignement/m1/math/projet/g8.gr|graphe 8]] Antoine
 +
*# [[silico:enseignement/m1/math/projet/g9.gr|graphe 9]] Romane
 +
*# [[silico:enseignement/m1/math/projet/g10.gr|graphe 10]] Nadine
 +
*# [[silico:enseignement/m1/math/projet/g11.gr|graphe 11]] Wanxing
 +
*# [[silico:enseignement/m1/math/projet/g12.gr|graphe 12]] Oussama
 +
*# [[silico:enseignement/m1/math/projet/g13.gr|graphe 13]] Sandro
 +
*# [[silico:enseignement/m1/math/projet/g14.gr|graphe 14]] Mathias
 +
*# [[silico:enseignement/m1/math/projet/g15.gr|graphe 15]] Natacha
 +
*# [[silico:enseignement/m1/math/projet/g16.gr|graphe 16]] Nolan
 +
*# [[silico:enseignement/m1/math/projet/g17.gr|graphe 17]] Sophia
 +
*# [[silico:enseignement/m1/math/projet/g18.gr|graphe 18]] Ludovic
 +
*# [[silico:enseignement/m1/math/projet/g19.gr|graphe 19]] Maina
 +
*# [[silico:enseignement/m1/math/projet/g20.gr|graphe 20]] Jeanne
 +
*# [[silico:enseignement/m1/math/projet/g21.gr|graphe 21]]
 +
*# [[silico:enseignement/m1/math/projet/g22.gr|graphe 22]]
 +
*# [[silico:enseignement/m1/math/projet/g23.gr|graphe 23]]
 +
*# [[silico:enseignement/m1/math/projet/g24.gr|graphe 24]]
 +
 +
<!-- ARCHIVES
 +
 +
 +
'''Projet 2018-19:'''
 +
* [[silico:enseignement/m1/math/projet/M1BBS_Math_Sujet_Projet_2018-19.html|Sujet du projet 2018-19]]
 +
* constitution des groupes (2 personnes par groupe) pour le projet : https://framadate.org/M1BBS-Groupes-Projet-Math
 +
* Les projets sont à rendre '''avant''' les fêtes de fin d'année
 +
* Graphe à analyser pour chaque groupe
 +
*# [[silico:enseignement/m1/math/projet/g1.gr|Groupe 1]]
 +
*# [[silico:enseignement/m1/math/projet/g2.gr|Groupe 2]]
 +
*# [[silico:enseignement/m1/math/projet/g3.gr|Groupe 3]]
 +
*# [[silico:enseignement/m1/math/projet/g4.gr|Groupe 4]]
 +
*# [[silico:enseignement/m1/math/projet/g5.gr|Groupe 5]]
 +
*# [[silico:enseignement/m1/math/projet/g6.gr|Groupe 6]]
 +
*# [[silico:enseignement/m1/math/projet/g7.gr|Groupe 7]]
 +
*# [[silico:enseignement/m1/math/projet/g8.gr|Groupe 8]]
 +
*# [[silico:enseignement/m1/math/projet/g9.gr|Groupe 9]]
 +
*# [[silico:enseignement/m1/math/projet/g10.gr|Groupe 10]]
 +
 +
 +
 +
*# [[silico:enseignement/m1/math/projet/Cleandb_Luca_2_A_1_1_65_Iso_Tr_1-CC1.gr|Groupe 1]]
 +
*# [[silico:enseignement/m1/math/projet/Cleandb_Luca_2_A_1_1_65_Iso_Tr_1-CC2.gr|Groupe 2]]
 +
*# [[silico:enseignement/m1/math/projet/Cleandb_Luca_2_A_1_1_65_Iso_Tr_1-CC3.gr|Groupe 3]]
 +
*# [[silico:enseignement/m1/math/projet/Cleandb_Luca_3_A_1_1_65_Iso_Tr_1-CC1.gr|Groupe 4]]
 +
*# [[silico:enseignement/m1/math/projet/Cleandb_Luca_4_A_1_1_65_Iso_Tr_1-CC1.gr|Groupe 5]]
 +
*# [[silico:enseignement/m1/math/projet/Cleandb_Luca_4_A_1_1_65_Iso_Tr_1-CC2.gr|Groupe 6]]
 +
*# [[silico:enseignement/m1/math/projet/Cleandb_Luca_5_A_1_1_65_Iso_Tr_1-CC1.gr|Groupe 7]]
 +
*# [[silico:enseignement/m1/math/projet/|Groupe 8]]
 +
*# [[silico:enseignement/m1/math/projet/|Groupe 9]]
 +
*# [[silico:enseignement/m1/math/projet/|Groupe 10]]
 +
 +
 +
'''Projet 2017-18:'''
 +
* [[silico:enseignement/m1/math/projet/M1BBS_Math_Sujet_Projet_2017-18.html|Sujet du projet 2017-18]]
 +
* constitution des groupes (2 ou 3 personnes par groupe) pour le projet : https://framadate.org/RlOS3KoUKgmRHM5s
 +
* Les projets sont à rendre '''avant''' le 4 Décembre
 +
* Graphe à analyser pour chaque groupe
 +
*# [[silico:enseignement/m1/math/projet/Cleandb_Luca_2_A_1_1_65_Iso_Tr_1-CC1.gr|Groupe 1]]
 +
*# [[silico:enseignement/m1/math/projet/Cleandb_Luca_2_A_1_1_65_Iso_Tr_1-CC2.gr|Groupe 2]]
 +
*# [[silico:enseignement/m1/math/projet/Cleandb_Luca_2_A_1_1_65_Iso_Tr_1-CC3.gr|Groupe 3]]
 +
*# [[silico:enseignement/m1/math/projet/Cleandb_Luca_3_A_1_1_65_Iso_Tr_1-CC1.gr|Groupe 4]]
 +
*# [[silico:enseignement/m1/math/projet/Cleandb_Luca_4_A_1_1_65_Iso_Tr_1-CC1.gr|Groupe 5]]
 +
*# [[silico:enseignement/m1/math/projet/Cleandb_Luca_4_A_1_1_65_Iso_Tr_1-CC2.gr|Groupe 6]]
 +
*# [[silico:enseignement/m1/math/projet/Cleandb_Luca_5_A_1_1_65_Iso_Tr_1-CC1.gr|Marie G.]]
 +
 +
 +
<big>'''Exam TP'''</big>
 +
* Exam TP 2017-18 : [[silico:enseignement/m1/math/cc/|Sujet et fichiers à utiliser]]
 +
 +
<!--* [[Media:M1 MABS BBS Math Memento.pdf|Memento]] de Régine André-Obrecht-->
 +
 +
<!--
'''Contrôl continu décembre 2016'''
'''Contrôl continu décembre 2016'''
* Sujet au format [[silico:enseignement/m1/math/cc/2016.Math.CC.html|HTML]] et [[silico:enseignement/m1/math/cc/2016.Math.CC.Rmd|Rmd]] et l'image nécessaire pour la compilation au niveau du dernier exercice [[silico:enseignement/m1/math/cc/CC.nfbl.png|CC.nfbl.png]]
* Sujet au format [[silico:enseignement/m1/math/cc/2016.Math.CC.html|HTML]] et [[silico:enseignement/m1/math/cc/2016.Math.CC.Rmd|Rmd]] et l'image nécessaire pour la compilation au niveau du dernier exercice [[silico:enseignement/m1/math/cc/CC.nfbl.png|CC.nfbl.png]]
 +
-->
-
'''Projet 2016-17:'''
 
-
* [[silico:enseignement/m1/math/projet/M1BBS_Math_Sujet_Projet_2016-17.html|Sujet du projet 2016-17]]
 
-
* constitution des groupes (3 personnes par groupe) pour le projet : https://framadate.org/SRCce9gqmq5yfaBM
 
<!-- * [[M1 MABS CC Math 2012-12]] -->
<!-- * [[M1 MABS CC Math 2012-12]] -->
<!--
<!--
Line 421: Line 623:
-->
-->
-
'''Références'''
 
-
* ''Mathématiques pour les Sciences de la vie et de la Terre'' – C. David, S. Mustapha, F. Viens, N. Capron, edition Dunod
 
Line 450: Line 650:
==== Traitement de graphes et réseaux biologiques (EMBIA1KM) ====
==== Traitement de graphes et réseaux biologiques (EMBIA1KM) ====
-
 
-
<!--
 
-
'''Emploi du temps 2015-16'''
 
-
Les CM ont lieu en salle S20, les TP en salle 4TP4-P1.
 
-
{| class="wikitable"
 
-
!colspan="4"|EDT M1 Traitement de graphes et réseaux biologiques
 
-
|-
 
-
|                    || CM mardi 15h45-17h45 en S20    || TP mercredi 13h30-17h30 en 4TP4-P1
 
-
|-
 
-
| semaine 3 - 18.01    || RB CM1 Intro, notions et définitions ||
 
-
|-
 
-
| semaine 4 - 25.01    || RB CM2 représentation et premiers algo (DFS) ||
 
-
|-
 
-
| semaine 5 - 01.02    || RB CM3 algos (détection de cycles, tri topologique)        || RB TP1 Cytoscape, DFS Python
 
-
|-
 
-
| semaine 6 - 08.02    || RB CM4 algos (BFS, Dijkstra, Floyd-Warshall)        ||
 
-
|-
 
-
| semaine 7 - 15.02    || RB CM5 algos (MST Kruskall et Prim, Marches aléatoires, TribeMCL, Motif / Kavosh)        || RB TP2 BFS, plus courts chemins
 
-
|-
 
-
| semaine 8 - 22.01    || RB CM6 Dessin        ||
 
-
|-
 
-
| semaine 9 - 29.02    ||                      ||  RB TP3 dessin, librairie igraph
 
-
|-
 
-
| semaine 10 - 07.03  || YQ Partitionnement et détection de communautés        || YQ TP4 détection de communautés
 
-
|}
 
-
-->
 
'''Supports de cours'''
'''Supports de cours'''
* [[Media:Traitement_de_graphes_et_reseaux_biologiques.pdf|Support de cours]]
* [[Media:Traitement_de_graphes_et_reseaux_biologiques.pdf|Support de cours]]
 +
* [[Media:Traitement_des_graphes_et_reseaux_biologiques_communautes_v2019.pdf‎‎|Support de cours (communautés)]]
<!--
<!--
* [[Media:Traitement_des_graphes_et_reseaux_biologiques_communautes_v2013.pdf|Support de cours (communautés)]]
* [[Media:Traitement_des_graphes_et_reseaux_biologiques_communautes_v2013.pdf|Support de cours (communautés)]]
-
-->
 
-
* [[Media:Traitement_des_graphes_et_reseaux_biologiques_communautes_v2015.pdf‎|Support de cours (communautés)]]
 
 +
-->
'''Supports de TD/TP:'''  
'''Supports de TD/TP:'''  
-
* [[M1 BBS Graphes TP Visualisation|TP]] Visualisation et exploration de graphes
+
* [[Media:M1Bioinfo.Graphes.TD.definitions.pdf|TD1]] Définitions
-
* [[M1 BBS Graphes TP Librairie - Parcours de graphes|TP]] Librairie et parcours de graphes
+
* [[M1 BBS Graphes TP Visualisation|TP1]] Visualisation et exploration de graphes
-
* [[M1 BBS Graphes TP Dessin et Introduction iGraph|TP]] Dessin de graphes et initiation à la librairie iGraph
+
* [[M1 BBS Graphes TP Librairie - Parcours de graphes|TP1-2-3]] Librairie python et parcours de graphes
-
* [[M1 BBS Graphes TP Recherche de communautés dans les graphes|TP]] Recherche de communautés dans les graphes
+
* [[M1 BBS Graphes TP Librairies R - igraph|TP4]] Librairies R - Prise en main igraph
 +
* [[M1 BBS Graphes TP Recherche de communautés dans les graphes|TP5]] Recherche de communautés dans les graphes
 +
* [[M1 BBS Graphes TP Dessin et Introduction iGraph|TP archivé]] Dessin de graphes et initiation à la librairie iGraph
-
'''Projets 2016-17'''
+
 
 +
'''Projets 2020-21'''
* [[M1 BBS Graphes - Projets|Enoncé du projet]]
* [[M1 BBS Graphes - Projets|Enoncé du projet]]
 +
'''Liens:'''
'''Liens:'''
-
* [http://cytoscape.org/ Cytoscape] (et [http://cytoscapeweb.cytoscape.org/ Cytoscape Web] mais un peu dépassé maintenant)
+
Logiciels
-
* [http://tulip.labri.fr/TulipDrupal/ Tulip]
+
* [http://cytoscape.org/ Cytoscape] (et [https://js.cytoscape.org/ librairie pour l'analyse et la visualisaiton])
 +
* [http://tulip.labri.fr/TulipDrupal/ Tulip] librairie C/C++ pour le traitement et la visualisation de graphes
* [https://gephi.org/ Gephi]
* [https://gephi.org/ Gephi]
-
* [http://igraph.org/ igraph]
+
 
 +
Librairies
 +
* [http://igraph.org/ igraph] R, python, ...
 +
* [http://networkx.github.io NetworkX] python
 +
* [https://graph-tool.skewed.de graph-tool] python
 +
* [https://www.bioconductor.org/packages/release/bioc/html/STRINGdb.html Bioconductor/STRINGdb] interface STRINGdb et R igraph
 +
 
 +
Serveurs & Banques
* [http://bioinformatics.ai.sri.com/ptools/ Pathway tools]
* [http://bioinformatics.ai.sri.com/ptools/ Pathway tools]
-
* [http://deim.urv.cat/~sgomez/radatools.php Radatools]
 
-
* [http://rsat.bigre.ulb.ac.be/rsat/index_neat.html NeAT]
 
* [http://www.metacyc.org/ METACYC]
* [http://www.metacyc.org/ METACYC]
* [http://string-db.org/ STRING]
* [http://string-db.org/ STRING]
-
* [https://www.bioconductor.org/packages/release/bioc/html/STRINGdb.html Bioconductor/STRINGdb] interface STRINGdb et R igraph
+
* [http://deim.urv.cat/~sgomez/radatools.php Radatools]
* [http://regulondb.ccg.unam.mx/ RegulonDb]
* [http://regulondb.ccg.unam.mx/ RegulonDb]
* [http://metanetx.org/ MetaNetX]
* [http://metanetx.org/ MetaNetX]
 +
 +
Formats
* Format GraphML http://graphml.graphdrawing.org/ et http://graphml.graphdrawing.org/primer/graphml-primer.html
* Format GraphML http://graphml.graphdrawing.org/ et http://graphml.graphdrawing.org/primer/graphml-primer.html
 +
 +
Autres
 +
* https://kateto.net/network-visualization Visu avec différents environnements et librairies
 +
* Visualisation de l'algorithme Floyd-Warshall https://www.cs.usfca.edu/~galles/visualization/Floyd.html
 +
* [http://exercism.io exercism.io] : améliorer son niveau de programmation dans différents langages (notamment R)
 +
* [http://rosalind.info rosalind] : apprentissage python en bioinformatique
'''Références'''
'''Références'''
Line 515: Line 707:
* <i>Kavosh: a new algorithm for finding network motifs</i>, Kashani <i>et al.</i>, BMC Bioinformatics, 2009. DOI:10.1186/1471-2105-10-318
* <i>Kavosh: a new algorithm for finding network motifs</i>, Kashani <i>et al.</i>, BMC Bioinformatics, 2009. DOI:10.1186/1471-2105-10-318
* <i>Pathway discovery in metabolic networks by subgraph extraction</i>, Faust <i>et al.</i>, Bioinformatics, 1211-1218, 2010. DOI:10.1093/bioinformatics/btq105
* <i>Pathway discovery in metabolic networks by subgraph extraction</i>, Faust <i>et al.</i>, Bioinformatics, 1211-1218, 2010. DOI:10.1093/bioinformatics/btq105
 +
 +
<!--
 +
'''Emploi du temps 2015-16'''
 +
Les CM ont lieu en salle S20, les TP en salle 4TP4-P1.
 +
{| class="wikitable"
 +
!colspan="4"|EDT M1 Traitement de graphes et réseaux biologiques
 +
|-
 +
|                    || CM mardi 15h45-17h45 en S20    || TP mercredi 13h30-17h30 en 4TP4-P1
 +
|-
 +
| semaine 3 - 18.01    || RB CM1 Intro, notions et définitions ||
 +
|-
 +
| semaine 4 - 25.01    || RB CM2 représentation et premiers algo (DFS) ||
 +
|-
 +
| semaine 5 - 01.02    || RB CM3 algos (détection de cycles, tri topologique)        || RB TP1 Cytoscape, DFS Python
 +
|-
 +
| semaine 6 - 08.02    || RB CM4 algos (BFS, Dijkstra, Floyd-Warshall)        ||
 +
|-
 +
| semaine 7 - 15.02    || RB CM5 algos (MST Kruskall et Prim, Marches aléatoires, TribeMCL, Motif / Kavosh)        || RB TP2 BFS, plus courts chemins
 +
|-
 +
| semaine 8 - 22.01    || RB CM6 Dessin        ||
 +
|-
 +
| semaine 9 - 29.02    ||                      ||  RB TP3 dessin, librairie igraph
 +
|-
 +
| semaine 10 - 07.03  || YQ Partitionnement et détection de communautés        || YQ TP4 détection de communautés
 +
|}
 +
-->
==== Fouille de données (EMBIA2DM) ====
==== Fouille de données (EMBIA2DM) ====
Line 569: Line 787:
'''Projet'''
'''Projet'''
<!-- * [[M1 MABS BBS Data Mining Projet|Enoncé]] du projet -->
<!-- * [[M1 MABS BBS Data Mining Projet|Enoncé]] du projet -->
-
* [[silico:enseignement/m1/datamining/projet/sujet.html|Sujet]] 2016-17
+
* [[silico:enseignement/m1/datamining/projet/sujet.html|Sujet]]
 +
 
 +
 
'''Liens'''
'''Liens'''
Line 590: Line 810:
* <i>Data Mining: Concepts and Techniques</i>, J. Han and M. Kamber, 2006.
* <i>Data Mining: Concepts and Techniques</i>, J. Han and M. Kamber, 2006.
* ''GENECODIS: a web-based tool for finding significant concurrent annotations in gene lists'', Carmona-Saez ''et al.'', Genome Biology, 2007.
* ''GENECODIS: a web-based tool for finding significant concurrent annotations in gene lists'', Carmona-Saez ''et al.'', Genome Biology, 2007.
 +
* Petit cours d'autodéfense intellectuelle, Normand Baillargeon, 2006
=== Master 1 - MEEF ===
=== Master 1 - MEEF ===
Line 597: Line 818:
'''Supports de TD :'''
'''Supports de TD :'''
* [[Media:1516_Gaulin_TD_PlantesDom.pdf|TD Plantes Domestiquees]]
* [[Media:1516_Gaulin_TD_PlantesDom.pdf|TD Plantes Domestiquees]]
 +
<!--
 +
 +
* [[Media:15_TD_Dom_CORRECTION.pdf|TD Plantes Domestiquees Correction]]
* [[Media:15_TD_Dom_CORRECTION.pdf|TD Plantes Domestiquees Correction]]
 +
-->
 +
-
'''Supports de Cours :'''
 
-
* [[Media:1617_PlantesDomes.pdf|CM Plantes Domestiquees]]
 
<!--
<!--
 +
* [[Media:1617_PlantesDomes.pdf|CM Plantes Domestiquees]]
 +
-->
-->
== Master 2 ==
== Master 2 ==
 +
=== Master 2P Diagnostic moléculaire en microbiolgy ===
 +
=====Supports de cours =====
 +
* [[Media:annotation2_M2Diag_2020.pdf|Annotation génomes bactériens (Gwennaele Fichant)]]
 +
<!-- * [[Media:Phylogenie_Definitions_2018_M2Diag.pdf|Définitions en phylogénie (Gwennaele Fichant)]] -->
 +
* [[Media:Introduction_Phylogenie_2019_M2Diag.pdf|Introduction à la reconstruction phylogénétique (Gwennaele Fichant)]]
 +
<!--* [[Media:annotation1_M2Diag_2018.pdf|Annotation partie 1 (Gwennaele Fichant)]]
 +
* [[Media:annotation2_M2Diag_2018.pdf|Annotation partie 2 (Gwennaele Fichant)]]
 +
* [[Media:Blast_2016.pdf|Recherche par similarité dans les bases de données (cours de L3 Bioanalyse)]]-->
-
=== Master 2 - Bioinformatique et Biologie des Systèmes ===
+
=====Tutoriels de TP=====
 +
*[[silico:enseignement/m1-bioinfo/BG/TD_annotation/Tutorial_annotation_v1_2019.html|Annotation d'un fragment génomique bactérien]]
-
* [[M2BBS - Atelier Système]]  
+
* [[silico:enseignement/m1-mabs/EvolMol/TD1/index.html|Analyse évolutive de la cascade de régulation de la compétence chez les Streptocoques]]
 +
* [[Media:Introduction_competence_2017.pdf|Petit topo d'introduction sur la régulation de la compétence chez ''S. pneumoniae'']]
 +
 
 +
* [[silico:enseignement/m2pro-diag/Bioinfo/TD_16srRNA/16SRNA_Tutorial_de _BioInformatique.htm|Identification des bactéries à l'aide de l'ARNr 16S]]
 +
 
 +
=== Master 2 - Bioinformatique et Biologie des Systèmes ===
<!-- * [[silico:enseignement/m2pro-bioinfo/Annotation.html|TD Annotation Artemis]]
<!-- * [[silico:enseignement/m2pro-bioinfo/Annotation.html|TD Annotation Artemis]]
Line 616: Line 856:
-->
-->
 +
===== Atelier système =====
 +
* [[M2BBS - Atelier Système]]
 +
 +
==== Atelier Chipseq ====
 +
**[[silico:enseignement/m2BBS/ChipSeq/TP_CHIPSEQ_2019_M2Bioinfo_FolderEtudiants.tar.gz|données TP]]
 +
 +
====Atelier Galaxy ====
 +
 +
* http://genoweb.toulouse.inra.fr/~formation/8_Galaxy_Admin/2019/
 +
 +
==== UE Communication ====
-
===== UE Communication =====
 
=====liste des publications à présenter en préparation des ateliers:=====
=====liste des publications à présenter en préparation des ateliers:=====
-
'''Chaque publication sera choisie par deux étudiant(e)s. La présentation de la publication est personnelle. Donc chaque personne préparera une présentation powerpoint (ou pdf), diapositives en anglais, de 15 minutes qui sera suivie de 10 minutes de questions. Attention, ne pas oublier de récupérer les supplementary data si il y en a et qu'ils ne vous sont pas fournis et bien entendu de les consulter. La présentation devra faire ressortir la problématique abordée (question posée et contexte), la démarche bioinformatique adoptée, les résultats sous forme synthétisée avec choix pertinent des figures pour illustrer votre propos et la conclusion/discussion.
+
'''Chaque publication sera choisie par deux étudiant(e)s. La présentation de la publication est personnelle. Donc chaque personne préparera une présentation powerpoint (ou pdf), diapositives en anglais, de 15 minutes qui sera suivie de 10 minutes de questions. La présentation et les questions se feront en français. Attention, ne pas oublier de récupérer et de lire les supplementary data qui sont aussi important pour la compréhension de l'article. La présentation devra faire ressortir la problématique abordée (question posée et contexte), la démarche bioinformatique adoptée, les résultats sous forme synthétisée avec choix pertinent des figures pour illustrer votre propos et la conclusion/discussion.
'''
'''
-
* '''Atelier Biologie des Systèmes'''
+
* '''Atelier Métabolomique'''
 +
** Article 1 :
 +
*** [[Media:Cell_2020.pdf|A Deep Learning Approach to Antibiotic Discovery]]
 +
*** [[Media:Cell_2020_supdata.zip |Supplementary information]]
** Article 1 :
** Article 1 :
-
*** [[Media:Toni_et_al_2011.pdf|Toni_2011_BMC_System_Biology]]
+
*** [[Media:Nature_com_2018.pdf|Pan-cancer analysis of transcriptional metabolic dysregulation using The Cancer Genome Atlas]]
-
*** [[Media:2011_Toni_supplement.pdf|Toni_2011_BMC_System_Biology_SupData]]
+
*** Supplementary information à récupérer sur https://www.nature.com/articles/s41467-018-07232-8#additional-information
* '''Atelier ChipSeq'''
* '''Atelier ChipSeq'''
** Article 1 :  
** Article 1 :  
-
*** [[Media:Jager-2015.pdf|Jäger_Nature_communication_2015]]
+
*** [[Media:GenomeBiol2008.pdf|Model-based Analysis of ChIP-Seq (MACS)]]
 +
*** [[Media:MACS_Sup_data.pdf |Supplementary information]]
** Article 2 :  
** Article 2 :  
-
*** [[Media:Pugh.pdf|Rhee_and_Pugh_Cell_2011]]
+
*** [[Media:Buenrostro_2018.pdf|Integrated Single-Cell Analysis Maps the Continuous Regulatory Landscape of Human Hematopoietic Differentiation]]
 +
*** Supplementary information à récupérer sur https://www.sciencedirect.com/science/article/pii/S009286741830446X?via%3Dihub
-
* '''Atelier Modélisation Moléculaire'''
+
* '''Atelier Phylogénomique'''
** Article 1 :  
** Article 1 :  
-
*** [[Media:Kossida_2013.pdf|Vlachakis_and_Kossida_PeerJ_2013]]
+
*** [[Media:ecceTERA.pdf| ecceTERA: comprehensive gene tree-species tree reconciliation using parsimony]]
 +
*** [[Media:ecceTERA_Supplementary_Data.zip| Supplementary information à lire impérativement]]
 +
** Article 2
 +
***[[Media:Ali_et_al_2019.pdf|Identifying Clusters of High Confidence Homologies in Multiple Sequence Alignments]]
-
* '''Atelier Genome'''
+
* '''Atelier Modélisation'''
** Article 1 :
** Article 1 :
-
*** [[Media:Rajagopal_al_Plos_Computational_2013.pdf|Rajagopal_al_Plos_Computational_2013]]
+
*** [[Media:Weyder_et_al_2018.pdf|Dynamic Modeling of Streptococcus pneumoniae Competence Provides Regulatory Mechanistic Insights Into Its Tight Temporal Regulation]]
 +
*** Supplementary information à récupérer sur https://www.frontiersin.org/articles/10.3389/fmicb.2018.01637/full#supplementary-material
 +
** Article 2 :
 +
*** [[Media:Li_et_al_2008.pdf|A Quantitative Study of the Division Cycle of Caulobacter crescentus Stalked Cells]]
 +
*** Supplementary information à récupérer sur https://journals.plos.org/ploscompbiol/article?id=10.1371/journal.pcbi.0040009
-
===== Calendrier des présentations =====
+
===== Calendrier des présentations d'articles =====
{| class="wikitable"
{| class="wikitable"
-
!colspan="2"|EDT présentation des articles (les noms sont donnés pour rappel mais ordre de passage indifférent)
+
!colspan="5"|EDT présentation des articles (les noms sont donnés pour rappel mais ordre de passage indifférent)
|-
|-
-
|lundi 10 octobre 9h30-10h30 :
+
|lundi 28 septembre 9h30-12h :
-
|article Atelier Modélisation Moléculaire (Alexandra, Soukaïna))
+
|articles Atelier Phylogénomique
 +
|article 1 : 9H30-10h30 (Codé, Laura D)
 +
|article 2 : 10h40-11h40 (Laura B, Tomas)
 +
||Commentaires : 11h40-12h
|-
|-
-
|lundi 10 octobre 10h30-11h45 : (pause de 11h à 11h15)
+
|lundi 28 septembre 13h45-16h15 :
-
| article Atelier Biologie des Systèmes (Leila, Raphael)
+
|articles Atelier Modélisation
 +
|article 1 : 13H45-14h45 (Alexia, Aurélien)
 +
|article 2 : 14h55-15h55 (Pierre, Safia)
 +
|Commentaires : 15h55-16h15
|-
|-
-
|lundi 10 octobre 11h45-12h35 :
+
|mardi 29 septembre 9h30-12h :  
-
| article Atelier Génome (David, Adrien)
+
|article Atelier Métabolomique
 +
|article 1 : 9H30-10h30 (Baptiste, Quentin)
 +
|article 2 : 10H40-11h40 (Antoine, Sophie)
 +
|Commentaires : 11h40-12h
|-
|-
-
|lundi 10 octobre 14h30-17h :
+
|mardi 28 septembre 13h45-16h15 :
-
| articles Atelier ChipSeq (Emilie, Laurent,Léa,Thomas)
+
|articles Atelier ChipSeq
 +
|article 1 : 13h45-14h45 (Jérémy, Valentine)
 +
|article 2 : 14h55-15h55 (Houyem, Refka)
 +
|Commentaires : 15h55-16h15
|}
|}
-
===== Intégration de Données Hétérogènes - Partie R. Barriot =====
+
==== Intégration de Données Hétérogènes - Partie R. Barriot ====
-
* [[Media:M2BBS - Integration de Donnees Heterogenes.pdf|Support de cours]]
+
* [[Media:M2BBS - Integration de Donnees Heterogenes - Generalites.pdf|Approches]]
 +
* [[Media:M2BBS - Integration de Donnees Heterogenes - Enrichissement.pdf|Enrichissement]]
 +
* [[Media:M2BBS - Integration de Donnees Heterogenes - Priorisation.pdf|Fusion de données et priorisation de gènes candidats]]
* [[M2BBS - IDH|Mise en oeuvre]]  
* [[M2BBS - IDH|Mise en oeuvre]]  
* [[M2BBS Integration de Donnes Heterogenes - Projets|Projets IDH]]
* [[M2BBS Integration de Donnes Heterogenes - Projets|Projets IDH]]
-
===== Biologie des Systèmes - G. Fichant =====
+
<!--
 +
==== Atelier Génétique Satistique - S. Boitard ====
 +
Support de cours et TD:
 +
* [[Media:coal_cours.pdf|Coalescence : principe et bases théoriques]] '''
 +
* [[Media:coal_td.pdf|TD de génétique des populations]] '''
 +
* [[Media:tp_struc.pdf|TP : Diversité génétique d’une population structurée]] '''
 +
* [[Media:Mol_Biol_Evol-1999-Pritchard-1791-8.pdf|article : investigation de l'histoire démographique du chromosome Y par analyse des loci microsatellite]] '''
 +
* [[Media:cours_tp_hapFLK.pdf|cours et TP de détection de locus sous sélection positive]] '''
 +
 
 +
'''TP :'''
 +
*[[Media:tp_coal.pdf|TP : simulations de données génétiques par coalescence fichier format pdf]] '''
 +
*[[silico:enseignement/m2BBS/Genet_Stat/tp_coal.html|TP : simulations de données génétiques par coalescence fichier format html]]
 +
*[[Media:tp_abc.pdf|TP estimation de paramètres par une approche ABC]] '''
 +
*[[https://github.com/willyrv/BioInfoCours]] autres documents
 +
-->
 +
 
 +
====Atelier Phylogénomique====
 +
Intervenants : Claire Hoede et Yves Quentin
 +
 
 +
[http://silico.biotoul.fr/p/Atelier_Phylog%C3%A9nomique Atelier de Phylogénomique]
 +
 
 +
<!--
 +
===== Biologie des Systèmes - R. Barriot =====
 +
* [[Media:GRNs.pdf|Réseaux de régulation]] '''
 +
* [[M2 BBS TP GRNs]]
 +
-->
 +
 
 +
==== Biologie des Systèmes - G. Czaplicki ====
 +
 
 +
* [[Media:document_GC.pdf|Support de cours]] '''
 +
 
 +
Fichiers avec les codes :
 +
* [[Media:banana.m|banana.m]] '''
 +
* [[Media:ftest.m|ftest.m]] '''
 +
* [[Media:Rate.m|Rate.m]] '''
 +
* [[Media:SMarquardt.m|SMarquardt.m]] '''
 +
* [[Media:compet.dat|compet.dat]] '''
 +
 
 +
==== Biologie des Systèmes - G. Fichant ====
Support de cours:
Support de cours:
-
* [[Media:Intro_BioSyst.pdf|Short general introduction to system biology]] '''
+
* [[Media:Intro_BioSyst_2017.pdf|Introduction to system biology]] '''
-
* [[Media:SCAN_rappel_enzymo.pdf|Petit rappel enzymologie partie 1 ]]'''
+
* [[Media:Rappel_enzymo_v1.pdf|Petit rappel enzymologie]]'''
-
* [[Media:Rappel_enzymo_v1.pdf|Petit rappel enzymologie partie 2 ]]'''
+
* [[Media:SCAN_rappel_enzymo.pdf|Complément rappel enzymologie]]'''
-
* [[Media:network_motifs.pdf|Two and three nodes network motifs in transcriptional networks]]'''
+
* [[Media:Petri_net_2020.pdf|Introduction to Petri net models]]'''
-
* [[Media:Petri_net_2015.pdf|Introduction to Petri net models]]'''
+
* [[Media:Modele_stochastique.pdf|Introduction to stochastic simulation]]'''
-
* [[Media:Intro_PL_2015.pdf|Introduction to Piece-wise linear differential equation models]]'''
+
* [[Media:parameter_estimation_2019.pdf|Introduction parameter estimation]]'''
 +
* [[Media:Intro_PL_2020.pdf|Introduction to Piece-wise linear differential equation models]]'''
* [[Media:Model_analysis.pdf| System dynamic analyses ]]'''
* [[Media:Model_analysis.pdf| System dynamic analyses ]]'''
 +
* [[Media:SBML.pdf| Bref introduction au standard SBML ]]'''
 +
 +
<!--* [[Media:network_motifs.pdf|Two and three nodes network motifs in transcriptional networks]]'''-->
<!-- * [[Media:parameter_estimation.pdf| Parameter estimation (M. Weyder)]]''' -->
<!-- * [[Media:parameter_estimation.pdf| Parameter estimation (M. Weyder)]]''' -->
'''TP :'''
'''TP :'''
 +
* [[Media:CopasiUserguide-20100803-1.pdf|Copasi user guide]]
 +
* [[Media:Aide_Copasi.pdf|mnémo pour prise en main de Copasi plus simulation avec R]]
 +
* Lien vers le site de Snoopy : https://www-dssz.informatik.tu-cottbus.de/DSSZ/Software/Snoopy
 +
*'''TP1 : modeling of the psp response when cell envelop  is damaged'''
*'''TP1 : modeling of the psp response when cell envelop  is damaged'''
-
** [[Media:psp_system_dm.txt|membrane data]]
+
** [[Media:TP_psp_response.pdf|Short description the biological process]]
 +
<!--** [[Media:Modele_psp_extended_PN.xpn|Modèle corrigé du réseau qualitatif]] -->
 +
** [[Media:Modele_psp_save_essai_2019_modif_constante.spn|Modèle corrigé du réseau stochastique]]
 +
 
 +
<!-- ** [[Media:constante_stochastic_2017-18.png|constantes stochastiques]]
 +
<!--** [[Media:Toni_et_al_2011.pdf|article support]]  -->
 +
<!--** [[Media:constante_stochastic_2017-18.png|constantes stochastiques]] -->
 +
<!-- ** [[Media:modele_psp_save_2017-18.spn|Modèle stochastique corrigé]] -->
 +
<!--** [[Media:psp_system_dm.txt|membrane data]]
** [[Media:psp_system_hBCA.txt|hBCA data]]
** [[Media:psp_system_hBCA.txt|hBCA data]]
** [[Media:psp_system_olg.txt|olg data]]
** [[Media:psp_system_olg.txt|olg data]]
** [[Media:psp_system_hBCAF.txt|hBCAF data]]
** [[Media:psp_system_hBCAF.txt|hBCAF data]]
-
** [[Media:psp_system_hBcCcA.txt|hBcAcCc data]]
+
** [[Media:psp_system_hBcCcA.txt|hBcAcCc data]]-->
-
*'''TP2 : modeling of the regulation of lactose operon :'''
+
 
-
** [[Media:operon_lactose.pdf|Short biological description of the lactose operon regulation]]
+
 
-
** [[Media:constantes.txt|constant file]]
+
*'''TP2 : modeling of the repressilator:'''
 +
** [[Media:tp_repressilator_2019.pdf|Short description of the repressilator regulation]]
 +
** [[Media:repressilator_continu_2018_time_serie_500.csv|protein time series data]]
 +
** [[Media:repressilator_stochastique_2019.spn|Modèle corrigé du réseau stochastique]]
 +
** [[Media:repressilator_continu_2020.cpn|Modèle corrigé du réseau continu avec Snoopy]]
 +
 
 +
<!-- ** [[Media:repressilator_prot.cps|Modèle corrigé Copasi]] -->
 +
<!-- ** [[Media:repressilator.Rmd|script R pour intégration ODE]]-->
 +
 
 +
 
 +
<!-- ** [[Media:constante_stochastique.png|stochastic constant file]]
 +
** [[Media:constante_continu.png|ODE parameter file]] -->
 +
 
 +
*'''TP3 : modeling phosphate regulation in enterobacteria:'''
 +
** [[Media:TP_phosphate_new_2018.pdf|Short biological description of the phosphate regulation]]
 +
** [[Media:Modele_stochastique_switch.spn|Modèle corrigé du réseau stochastique]]
 +
<!--** [[Media:PN_extended_phosphate.xpn| Modèle corrigé du réseau qualitatif]]-->
 +
 
 +
<!-- ** [[Media:PN_extended_phosphate.xpn|Modèle "extended Petri Net" corrigé]]-->
 +
<!-- ** [[Media:modele_stochastique_switch.spn|Modèle stochastique corrigé]]-->
 +
 
 +
 
 +
'''TP4 : modeling of the regulation of lactose operon : CR à rendre avant 20h le 11/12/2020'''
 +
** [[Media:operon_lactose_description_2018.pdf|'''TP à rendre''' Short biological description of the lactose operon regulation]]
 +
** [[Media:operon_lac_2018_last.spn|'''Modèle stochastique corrigé''']]
 +
** [[Media:res_stochastique_lactose_3pics.PNG|'''Capture écran lactose input''']]
 +
** [[Media:res_stochastique_prot_3pics.PNG| '''Capture écran comportement des protéines''']]
 +
<!-- ** [[Media:constantes_2017.txt|stochastic constant file]]
 +
** [[Media:Constante_parameter_lactose_stochastique_2017.PNG|screen shot of the constant definition in the model]]-->
=== Master 2 - [http://sciences-vegetales.univ-tlse3.fr/presentation-m2-adam-609174.kjsp?RH=1449138073206&RF=1450299526893 ADAM] (Adaptation, Développement et Amélioration des plantes en présence de Microorganismes)===
=== Master 2 - [http://sciences-vegetales.univ-tlse3.fr/presentation-m2-adam-609174.kjsp?RH=1449138073206&RF=1450299526893 ADAM] (Adaptation, Développement et Amélioration des plantes en présence de Microorganismes)===
Line 694: Line 1,052:
'''Documents, partie E. Gaulin'''
'''Documents, partie E. Gaulin'''
-
* [[M2R_BV|Clonage in silico]]
+
* [[M2R_ADAM|Clonage in silico_BenchLing]]
 +
* [[M2R_BV|Clonage in silico_pDRAW]]
 +
 +
 +
<!--
 +
 +
-------------------------------------------------------
 +
'''Examen 2020-2021'''
 +
 +
 +
'''Partie E. Gaulin'''
 +
 +
Veuillez trouver ci-dessous, la séquence fasta de l'ADNc PEP2 du champignon que l'on souhaite cloner dans le vecteur de destination pCAMBIA
 +
 +
'''>ADNc_PEP2'''
 +
 +
ACTTCCAAATTCTAGTATATGTAATCCTTTT
 +
GTTCGGGTTCATGATCGAATTCCAAAGAGTGGAAAACAAGCAAAAGGTTAAATATACATG
 +
CCATTTTTGGAGCTTTCGAGCTCATAACACAGGTGAGCGCGACGAATGGATCCCTCGCTA
 +
ATAACATCATGGTCGTGGGCGCCGTCCTTGCGGCGCTCGTCGCCGGCGGGTCGTGCGGGC
 +
CCCCGAAGGTGCCACCCGGCCCCAACATCACCACCAACTACAACGGCAAGTGGCTCACCG
 +
CTAGGGCCACCTGGTACGGTCAGCCCAACGGTGCCGGCGCTCCTGACAACGGCGGTGCGT
 +
GCGGGATCAAGAACGTGAACCTGCCACCCTACAGCGGCATGACGGCGTGCGGCAACGTCC
 +
CCATCTTCAAGGACGGCAAGGGCTGCGGCTCATGCTACGAGGTGAGATGCAAGGAAAAAC
 +
CTGAGTGCTCGGGCAATCCAGTCACGGTGTACATCACTGACATGAACTACGAACCTATCG
 +
CTCCCTACCACTTCGACTTGAGCGGCAAGGCCTTCGGCTCCCTGGCAAAGCCCGGGCTCA
 +
ACGACAAGATTCGCCACTGCGGCATCATGGACGTCGAGTTCAGAAGGGTGCGATGCAAGT
 +
ACCCCGCCGGGCAGAAGATCGTGTTCCACATCGAGAAGGGCTGCAACCCCAACTACCTGG
 +
CCGTGCTGGTGAAGTATGTGGCGGACGACGGCGACATCGTGCTGATGGAAATCCAGGACA
 +
AGTTGTCGGCTGAGTGGAAGCCCATGAAGCTCTCTTGGGGCGCCATCTGGAGGATGGACA
 +
CTGCCAAGGCGCTCAAGGGCCCCTTCTCCATCCGCCTCACCAGCGAGTCCGGCAAGAAGG
 +
TCATCGCCAAAGACGTCATCCCGGCGAACTGGAGACCCGATGCCGTCTACACTTCCAACG
 +
TCCAATTTTACGTAACTTTGAATTCCCTTCGATTCATCCGGCACAGCGGGCTATGGACCT
 +
TCAGCAGCAAGCTAATTAAGTTGGCAGCATGCACCGCTAACCTTATATACTACTGAGACT
 +
TCCAAATTCTAGTATATGTAATCCTTTTGTTCGGGTTCATGATCGAATTCCAAAGAGTGG
 +
AAAACAAGCAAAAGGTTAAATATACATGCCATTTTTGGAAGCTTGGCTTTCGAGGGTACC
 +
CCTGATAGTT
 +
 +
 +
'''Partie C. Mathé'''
 +
* [http://genoweb.toulouse.inra.fr/~mathe/M2RBV/Exam_Blast.htm Lien vers un BLAST sauvegardé]
 +
 +
 +
'''Partie C. Albenne'''
 +
 +
*[[Media:EXPB1b.doc|EXPB1]]
 +
*[[Media:2hcz.dsv|Structure]]
 +
 +
 +
-------------------------------------------
 +
 +
 +
'''Examen 2018-2019'''
 +
 +
'''Partie E. Gaulin'''
 +
* [[M2R|Cartes et Sites de Restriction]]
 +
 +
'''Partie C. Mathé'''
 +
* [http://genoweb.toulouse.inra.fr/~mathe/M2RBV/Exam_Blast.htm Lien vers un BLAST sauvegardé]
 +
 +
'''Partie C. Albenne'''
 +
*[[Media:M2R_2018-Albenne.pdf|Sujet C Albenne]]
 +
 +
 +
*[[Media:EXPB1.doc|EXPB1]]
 +
*[[Media:2hcz.dsv|Structure]]
 +
 +
 +
 +
---------------------------------------------
 +
 +
 +
'''Examen 2017, partie E. Gaulin''' <br>
 +
 +
'''Documents, sujet C Albenne'''
 +
*[[Media:M2R_2017-Albenne.pdf|Sujet C Albenne]]
'''Examen 2016, partie E. Gaulin''' <br>
'''Examen 2016, partie E. Gaulin''' <br>
Line 701: Line 1,134:
*[[M2ADAM|Cartes et Sites de Restriction]]
*[[M2ADAM|Cartes et Sites de Restriction]]
-
<!--
 
'''Examen 2015'''
'''Examen 2015'''
'''Documents, partie E. Gaulin'''
'''Documents, partie E. Gaulin'''
* [[M2R|Cartes et Sites de Restriction]]
* [[M2R|Cartes et Sites de Restriction]]
-
-->
+
 
-
'''Documents, partie C. Mathé'''
+
-
* [http://snp.toulouse.inra.fr/~mathe/M2RBV/Exam_Blast.htm Lien vers un BLAST sauvegardé]
+
'''Documents, partie C. Albenne'''
'''Documents, partie C. Albenne'''
* [[Media:EXP1.doc|Sequence fasta EXPB1]]
* [[Media:EXP1.doc|Sequence fasta EXPB1]]
* [[Media:2HCZ.pdb|Structure PDB]]
* [[Media:2HCZ.pdb|Structure PDB]]
 +
 +
-------------------------------------------------
 +
 +
==== Biologie Computationnelle (2019) ====
 +
 +
* [[M2R_ADAM|In silico cloning]]
 +
 +
-->
 +
 +
= Culture =
 +
 +
* Une histoire de tout ou presque... Bill Bryson, Payot, coll. "Petite Bibliothèque Payot" n° 851, 2012 (ISBN: 9782228907576)
 +
* Norman Baillargeon - Petit cours d'autodéfense intellectuelle, Éditions Lux, collection Instinct de Liberté, 2005. (ISBN: 2-895960-44-5)
 +
* Faire l'économie de la haine, Alain Deneault, 2018, Ecosociete Eds, coll. Polemos
 +
* Comment tout peut s'effondrer. Petit manuel de collapsologie à l'usage des générations présentes. 2015. Pablo Servigne, :Raphaël Stevens. seuil
 +
* Les sentiers de l'utopie, I. Fremeaux et J. Jordan, 2012.
= F.A.Q. =
= F.A.Q. =

Current revision as of 08:55, 18 January 2021


Contents

Licence 2 et 3 Biologie

Bioinformatique - Option L2-L3 2B2M-BCP-BOPE

UE en option avec différents codes :

  • L2 2B2M : EDSVB4IM
  • L2 BCP : EDSVA4HM
  • L2 BOPE : EDSVC4MM
  • L3 BOPE : ELSVC6JM

Emploi du temps 2019-20

Aussi disponible sur https://calendar.google.com/calendar/embed?src=lic.bioinfo%40gmail.com&ctz=Europe/Paris


Les groupes de TD et TP 2019-20 sont disponibles sur moodle : https://moodle.univ-tlse3.fr/course/view.php?id=2518


EDT L2-L3 2B2M-BCP-BOPE Bioinformatique
CM TD TP
semaine 03 - 18/01 13h45-15h45 R. Barriot Bioinfo générale (lien zoom sur moodle)
16h00-18h00 F. Delavoie Imagerie
semaine 04 - 25/01 13h45-15h05 groupe TP1a en U1-205 et TP1b en U1-206

15h15-16h35 groupe TP2c en U1-205 et TP2d en U1-206
16h45-18h05 groupe TP3e en U1-205 et TP3f en U1-206

semaine 05 - 01/02 13h45-15h45 R. Barriot Bases de Données 15h55-17h55 groupe TD1

18h05-20h05 groupe TD2

semaine 06 - 08/02 13h45-15h05 groupe TP1a en 4TP2-M6 et TP1b en 4TP2-M7

15h15-16h35 groupe TP2c en 4TP2-M6 et TP2d en 4TP2-M7
16h45-18h05 groupe TP3e en 4TP2-M6 et TP2f en 4TP2-M7

semaine 07 - 15/02 13h45-15h45 M. Bonhomme 15h55-17h55 2 groupes TP à 20 étudiant·e·s à distance
18h05-20h05 1 groupe TP à 10 étudiant·e·s en présentiel en 4TP4-P15
semaine 08 - 22/02
semaine 09 - 01/03 13h45-15h15 Contrôle avec report en 4A-Molliard

17h00-19h00 CM Banques de données et services bioinformatiques en ligne

semaine 10 - 08/03 13h45-15h05 groupe TP1a en 4TP4-P1 et TP1b en 4TP4-P15

15h15-16h35 groupe TP2c en 4TP4-P1 et TP2d en 4TP4-P15
16h45-18h05 groupe TP3e en 4TP4-P1 et TP3f en 4TP4-P15

semaine 11 - 15/03 13h45-15h55 groupe TD1

16h05-18h10 groupe TD2

semaine 12 - 16/03
semaine 13 - 23/03
semaine 14 - 30/03
semaine 15 - 12/04 13h45-15h15 Contrôle terminal anticipé en 4A-Molliard





Supports de cours

Sujets de TD/TP

BioAnalyse L3 BCP

2020_2021 Planning des Enseignements L3 BCP et répartition en séries de TPs (semestre 6 (ELSV6CM1))

Toutes les informations relatives à l'UE de Bioanalyse sont également disponibles dans l'espace dédié sur Moodle


Videos des Cours

Cours

TPs, année 2020_2021

TPs, versions antérieures à 2020_2021

Exemples de contrôle continu corrigé

BioAnalyse L3 2B2M

TPs

Licence 3 Biologie des Organismes des populations et Ecosystemes (BOPE)

Du génome à la sélection des plantes (ELSVC5EM)

Initiation à la 'Bioanalyse'


Master

Master 1

Master 1 - Bioinformatique et Biologie des Systèmes + Biologie Végétale ADAM

Génomique Evolutive et Phylogénie

Supports de TD/TP :

Medicago SNPs sequences
Drosophile sequences
Primates lysozymes sequences

Traitement de données biologiques (EMBIA1FM)

Supports de cours :

Supports de TD/TP :


Liens

Génétique Evolutive et Quantitative (EMBIA1GM)

Support de cours:

Supports de TD/TP :

Master 1 - Bioinformatique et Biologie des Systèmes + Biotechnologies

Evolution Moléculaire (EMBIA2EM)

Supports de cours :

Support TP :

Support TD :



Master 1 - Bioinformatique et Biologie des Systèmes


Bioinformatique pour la Génomique (EMBIA1DM)

Supports de cours :

Tutoriels de TP :

Aide pour la réalisation du projet annotation

Contrôle continu :

  • Rapport de TP sur le design d'un HMM à rendre au plus tard le lundi 12 octobre. M'envoyer par courrier le rapport en format pdf ainsi que le fichier en format texte comportant votre modèle avant estimation des probabilités et celui après estimation des probabilités.


Mathématique pour la Biologie (EMBIA1EM)

Sujets de TP :

  • TD Calcul matriciel
  • TD ACP
  • TD Modélisation
  • TD Probabilités


Liens :

  • http://exercism.io : améliorer son niveau de programmation dans différents langages (notamment R)

Références

  • Mathématiques pour les Sciences de la vie et de la Terre – C. David, S. Mustapha, F. Viens, N. Capron, edition Dunod

Projet 2020-21 :





Traitement de graphes et réseaux biologiques (EMBIA1KM)

Supports de cours

Supports de TD/TP:

  • TD1 Définitions
  • TP1 Visualisation et exploration de graphes
  • TP1-2-3 Librairie python et parcours de graphes
  • TP4 Librairies R - Prise en main igraph
  • TP5 Recherche de communautés dans les graphes
  • TP archivé Dessin de graphes et initiation à la librairie iGraph


Projets 2020-21


Liens: Logiciels

Librairies

Serveurs & Banques

Formats

Autres

Références

  • Introduction to Algorithms, Corsen, Leiserson and Rivest, MIT Press and McGraw-Hill
  • Detection of Functional Modules From Protein Interaction Networks, Pereira-Leal, Enright and Ozounis, PROTEINS: Structure, Function, and Bioinformatics, 49-57, 2004.
  • An efficient algorithm for large-scale detection of protein families, Enright, Van Dongen and Ozounis, Nucleic Acids Research, 1575-84, 2002 PMID:11917018
  • Kavosh: a new algorithm for finding network motifs, Kashani et al., BMC Bioinformatics, 2009. DOI:10.1186/1471-2105-10-318
  • Pathway discovery in metabolic networks by subgraph extraction, Faust et al., Bioinformatics, 1211-1218, 2010. DOI:10.1093/bioinformatics/btq105


Fouille de données (EMBIA2DM)

Support de cours:

Sujets de TD/TP

  • TD Classification, validation croisée et clustering

Projet


Liens

Références

  • Data Mining: Concepts and Techniques, J. Han and M. Kamber, 2006.
  • GENECODIS: a web-based tool for finding significant concurrent annotations in gene lists, Carmona-Saez et al., Genome Biology, 2007.
  • Petit cours d'autodéfense intellectuelle, Normand Baillargeon, 2006

Master 1 - MEEF

Sciences de la Vie (EE7BSVFM)

Supports de TD :


Master 2

Master 2P Diagnostic moléculaire en microbiolgy

Supports de cours
Tutoriels de TP

Master 2 - Bioinformatique et Biologie des Systèmes

Atelier système

Atelier Chipseq

Atelier Galaxy

UE Communication

liste des publications à présenter en préparation des ateliers:

Chaque publication sera choisie par deux étudiant(e)s. La présentation de la publication est personnelle. Donc chaque personne préparera une présentation powerpoint (ou pdf), diapositives en anglais, de 15 minutes qui sera suivie de 10 minutes de questions. La présentation et les questions se feront en français. Attention, ne pas oublier de récupérer et de lire les supplementary data qui sont aussi important pour la compréhension de l'article. La présentation devra faire ressortir la problématique abordée (question posée et contexte), la démarche bioinformatique adoptée, les résultats sous forme synthétisée avec choix pertinent des figures pour illustrer votre propos et la conclusion/discussion.

Calendrier des présentations d'articles
EDT présentation des articles (les noms sont donnés pour rappel mais ordre de passage indifférent)
lundi 28 septembre 9h30-12h : articles Atelier Phylogénomique article 1 : 9H30-10h30 (Codé, Laura D) article 2 : 10h40-11h40 (Laura B, Tomas) Commentaires : 11h40-12h
lundi 28 septembre 13h45-16h15 : articles Atelier Modélisation article 1 : 13H45-14h45 (Alexia, Aurélien) article 2 : 14h55-15h55 (Pierre, Safia) Commentaires : 15h55-16h15
mardi 29 septembre 9h30-12h : article Atelier Métabolomique article 1 : 9H30-10h30 (Baptiste, Quentin) article 2 : 10H40-11h40 (Antoine, Sophie) Commentaires : 11h40-12h
mardi 28 septembre 13h45-16h15 : articles Atelier ChipSeq article 1 : 13h45-14h45 (Jérémy, Valentine) article 2 : 14h55-15h55 (Houyem, Refka) Commentaires : 15h55-16h15

Intégration de Données Hétérogènes - Partie R. Barriot


Atelier Phylogénomique

Intervenants : Claire Hoede et Yves Quentin

Atelier de Phylogénomique


Biologie des Systèmes - G. Czaplicki

Fichiers avec les codes :

Biologie des Systèmes - G. Fichant

Support de cours:


TP :






TP4 : modeling of the regulation of lactose operon : CR à rendre avant 20h le 11/12/2020

Master 2 - ADAM (Adaptation, Développement et Amélioration des plantes en présence de Microorganismes)

Biologie Computationnelle

Documents, partie E. Gaulin


Culture

  • Une histoire de tout ou presque... Bill Bryson, Payot, coll. "Petite Bibliothèque Payot" n° 851, 2012 (ISBN: 9782228907576)
  • Norman Baillargeon - Petit cours d'autodéfense intellectuelle, Éditions Lux, collection Instinct de Liberté, 2005. (ISBN: 2-895960-44-5)
  • Faire l'économie de la haine, Alain Deneault, 2018, Ecosociete Eds, coll. Polemos
  • Comment tout peut s'effondrer. Petit manuel de collapsologie à l'usage des générations présentes. 2015. Pablo Servigne, :Raphaël Stevens. seuil
  • Les sentiers de l'utopie, I. Fremeaux et J. Jordan, 2012.

F.A.Q.

  • Installation de igraph sur CentOS 6.7 en P0

Sous R, l'installation d'igraph échoue avec le protocole https, il faut donc choisir un mirroir avec le protocol http : choseCRANmirror() dernier choix (http mirrors) puis Lyon2

R> chooseCRANmirror()
R> install.packages('igraph')


  • Installation de Rstudio sur CentOS 6.7 en P0

La dernière version de Rstudio desktop ne fonctionne pas pour CentOS6.7 (nécessite des librairies plus récentes). Il faut donc télécharger et installer la version serveur :

# Dans un terminal, passer root (super-utilisateur)
bash> su
# puis les commandes ci-dessous (sans le "root>")
root> wget https://download2.rstudio.org/rstudio-server-rhel-0.99.892-x86_64.rpm
root> yum install --nogpgcheck rstudio-server-rhel-0.99.892-x86_64.rpm

Ensuite, on accède à l'interface avec le navigateur : http://localhost:8787 avec un compte de la machine (normalement le compte guest)