silico.biotoul.fr
 

Enseignements

From silico.biotoul.fr

(Difference between revisions)
Jump to: navigation, search
(Biologie des Systèmes - G. Fichant)
(Atelier Chipseq)
 
(97 intermediate revisions not shown)
Line 2: Line 2:
=== Bioinformatique - 2B2M (EDSVB4IM), BCP (EDSVA4HM), BOPE (L2 EDSVC4MM, L3 ELSVC6JM) ===
=== Bioinformatique - 2B2M (EDSVB4IM), BCP (EDSVA4HM), BOPE (L2 EDSVC4MM, L3 ELSVC6JM) ===
-
<!--
+
<!-- TO UPDATE FOR 2019-2020
-
===='''Emploi du temps 2017-18'''====
+
===='''Emploi du temps 2018-19'''====
Aussi disponible sur https://calendar.google.com/calendar/embed?src=lic.bioinfo%40gmail.com&ctz=Europe/Paris
Aussi disponible sur https://calendar.google.com/calendar/embed?src=lic.bioinfo%40gmail.com&ctz=Europe/Paris
Line 14: Line 14:
!colspan="4"|EDT L2-L3 2B2M-BCP-BOPE Bioinformatique
!colspan="4"|EDT L2-L3 2B2M-BCP-BOPE Bioinformatique
|-
|-
-
|                      || CM U4-212                                 || TD        ||  TP
+
|                      || CM U4-211                                 || TD        ||  TP
|-
|-
-
| semaine 04 - 22.01  || 13h30-15h40 U4-212 RB Bioinfo générale     ||
+
| semaine 03 - 14.01  || 13h30-15h40 R. Barriot  Bioinfo générale           ||
|-
|-
-
| semaine 05 - 29.01  || 13h30-15h40 U4-212 FD Imagerie             ||          || 15h50-18h00 <br/> groupes 2B2M & BCP en 4TP2-M6 & M7 <br/> groupe BOPE en 4TP4-P15
+
| semaine 04 - 21.01  || 13h30-15h40 F. Delavoie Imagerie                   ||          || 15h50-18h00 groupes BOPE & BCP en 4TP2-M6 & M7 <br/> 18h10-20h20 groupe 2B2M en 4TP2-M6
|-
|-
-
| semaine 06 - 05.02   || 13h30-15h40 U4-212 RB BdD                  || 15h50-18h00 U2-115 & 116 ||
+
| semaine 05 - 28.01   || 13h30-15h40 R. Barriot  Bases de Données            || 15h50-18h00 U2-114 & U2-118 ||
|-
|-
-
| semaine 07 - 12.02  ||                                           ||          || 13h30-15h40 groupes 2B2M & BCP en 4TP2-M6 & M7 <br/> 15h50-18h00 groupe BOPE en 4TP4-P15
+
| semaine 06 - 04.02  ||                                                     ||          || 13h30-15h40 groupes GR.TP1&2 en 4TP2-M6 & M7 <br/> 15h50-18h00 groupe GR.TP3 en 4TP2-M6
|-
|-
-
| semaine 08 - 19.02  || 13h30-15h40 U4-212 MB                      ||          || 15h50-18h00 groupes 2B2M & BCP en 4TP2-M6 & M7, groupe BOPE en 4TP4-P15
+
| semaine 07 - 11.02  || 13h30-15h40 M. Bonhomme                            ||          || 15h50-18h00 groupes GR.TP1&2 en 4TP2-M6 & M7 <br/> 18h10-20h20 groupe GR.TP3 en 4TP2-M6
 +
|-
 +
| semaine 08 - 18.02  || '''13h30-15h30 Contrôle continu en 2A-Grignard'''                                            ||          ||
 +
|- 
 +
| semaine 10 - 04.03  || 13h30-15h40 G. Fichant SysBio                      ||          || 15h50-18h00 groupes GR.TP1&2 en 4TP2-M6 & M7 <br/> 18h10-20h20 groupe GR.TP3 en 4TP2-M6
|-
|-
-
| semaine 09 - 26.02   ||                                            ||           ||  
+
| semaine 11 - 11.03   ||                                            || 13h30-15h40 GR.TD1 en U2-114 <br/> 15h50-18h00 GR.TD2 en U2-114 ||  
|-
|-
-
| semaine 10 - 05.03  || '''15h50-17h50 Contrôle continu en 3TP2-Einstein'''              ||          ||
+
| semaine 13 - 25.03  ||                                           ||          || 13h30-15h40 groupe GR.TP1 en 4TP4-P0 <br/> 15h50-18h00 groupe GR.TP2 en 4TP4-P0<br/> 18h10-20h20 groupe GR.TP3 en 4TP4-P0
|-
|-
-
| semaine 11 - 12.03   || 13h30-15h40 U4-212 GF SysBio              ||          || 15h50-18h00 groupes 2B2M & BCP en 4TP2-M6 & M7, groupe BOPE en 4TP4-P15
+
| semaine 15 - 08.04   || '''13h30-15h30 Contrôle terminal anticipé  en U1-Mathis''' ||          ||  
|-
|-
-
| semaine 12 - 19.03  ||                                            || 13h30-15h40 groupe 1 en U2-114 <br/> 15h50-18h00 groupe 2 en U2-116 ||
+
| semaine 26 - 25.06   || '''7h45-9h45 Contrôle terminal session 2 en U3-104''' ||          ||  
-
|-
+
-
| semaine 13 - 26.03  ||                                            ||          || 13h30-15h40 groupe 2B2M en U2-215<br/> 15h50-18h00 groupe BCP en U2-215<br/> 18h10-20h20 groupe BOPE en U2-215
+
-
|-
+
-
| semaine 17 - 23.04   || '''13h30-15h30 Contrôle terminal anticipé'''   ||          ||  
+
|}
|}
 +
 +
END TO UPDATE FOR 2019-2020
-->
-->
 +
 +
 +
 +
 +
<!--
<!--
|-
|-
Line 65: Line 72:
|}
|}
 +
-->
===='''Supports de cours'''====
===='''Supports de cours'''====
Line 71: Line 79:
* CM3 [[Media:LBioinfo.systemes.d.information.pdf|Introduction aux bases de données]]
* CM3 [[Media:LBioinfo.systemes.d.information.pdf|Introduction aux bases de données]]
* CM4 [[Media:LBioinfo_Genetics_bis.pdf|Utilisation de l'information génétique en biologie]]
* CM4 [[Media:LBioinfo_Genetics_bis.pdf|Utilisation de l'information génétique en biologie]]
-
* CM5 [[Media:Intro_BioSyst_L2.pdf|Introduction à la biologie des système : initiation à la modélisation de réseaux de gènes]]
+
* CM5 [[Media:Intro_BioSyst_L2_2019.pdf|Introduction à la biologie des système : initiation à la modélisation de réseaux de gènes]]
===='''Sujets de TD/TP'''====
===='''Sujets de TD/TP'''====
Line 81: Line 89:
* [[Media:L2-L3 Bioinfo - TD Transcriptomique.pdf|TD2]] Transcriptomique
* [[Media:L2-L3 Bioinfo - TD Transcriptomique.pdf|TD2]] Transcriptomique
* [[Media:TP_modelisation_regulation_fls2.pdf|TP5 Modélisation d'un réseau de régulation]]
* [[Media:TP_modelisation_regulation_fls2.pdf|TP5 Modélisation d'un réseau de régulation]]
-
<!--* [[Media:TP_regulation_fls2.pdf|correction du TP5 Modélisation d'un réseau de régulation]]-->
+
** [[Media:snoopy.7z|archive installation de snoopy]]  
-
 
+
** [[Media:fls2_regulation_simplifie.spn|réseau de Petri stochastique pour la régulation de fls2]]
-
<!-- * [[Media:snoopy.7z|archive installation de snoopy]] -->
+
** [[Media:TP_regulation_fls2.pdf|correction du TP5 Modélisation d'un réseau de régulation]]
-
<!-- * [[Media:fls2_regulation_simplifie.spn|réseau de Petri stochastique pour la régulation de fls2]] -->
+
=== BioAnalyse L3 BCP ===
=== BioAnalyse L3 BCP ===
Line 91: Line 98:
==='''Planning des Enseignements L3 BCP semestre 6 (ELSV6CM1)'''===
==='''Planning des Enseignements L3 BCP semestre 6 (ELSV6CM1)'''===
-
Planning 2017_2018 : A venir
+
* [[Media:1819_Planning TPS CMs.pdf|Planning Bioanalyse L3 BCP 2018_2019]]
 +
* [[Media:presentation_UE_bioanalyse_2019.pdf|Présentation de l'UE]]
<!--
<!--
-
* [[Media:2017_Planning_bionalyse_ETUv2.pdf|Planning L3 BCP 2017_2018]]
 
-->
-->
Line 297: Line 304:
* [[Media: TP1_genetic_diversity_drift.zip|TP1 génétique des populations]]
* [[Media: TP1_genetic_diversity_drift.zip|TP1 génétique des populations]]
* [[Media: TD-Génétique_Quantitative_2018.pdf|TD2 génétique quantitative]]
* [[Media: TD-Génétique_Quantitative_2018.pdf|TD2 génétique quantitative]]
-
* [[Media: TP_herit_covariance.zip|TP2 génétique quantitative]]
+
* [[Media: TP_heritability.zip|TP2 génétique quantitative]]
* [[Media: TD-backcross.pdf|TD3 génétique quantitative liaison/association]]
* [[Media: TD-backcross.pdf|TD3 génétique quantitative liaison/association]]
* [[Media: TP2-measureLD.zip|TP3 génétique quantitative mesures DL]]
* [[Media: TP2-measureLD.zip|TP3 génétique quantitative mesures DL]]
Line 306: Line 313:
'''Supports de cours :'''
'''Supports de cours :'''
* [[Media:CM1_EM_intro.pdf|Introduction à l'évolution moléculaire]]
* [[Media:CM1_EM_intro.pdf|Introduction à l'évolution moléculaire]]
-
* [[Media:Phylogenie_Definitions_2015.pdf|Evolution moléculaire : définitions]]
+
* [[Media:Phylogenie_Definitions_2019.pdf|Evolution moléculaire : définitions]]
-
* [[Media:Phylogenie_Modeles_Evolutifs_2018.pdf|Modèles évolutifs]]
+
* [[Media:Phylogenie_Modeles_Evolutifs_2019.pdf|Modèles évolutifs]]
-
* [[Media:Phylogenie_Methodes_2014.pdf|Méthodes de reconstructions phylogénétiques ]]
+
* [[Media:Phylogenie_Methodes_2019.pdf|Méthodes de reconstructions phylogénétiques ]]
* [[Media:Phylogenie_Methodes_part2_2014.pdf|Méthodes de reconstructions phylogénétiques (suite)]]
* [[Media:Phylogenie_Methodes_part2_2014.pdf|Méthodes de reconstructions phylogénétiques (suite)]]
-
* [[Media:CM6_EM_adapt_mol1.pdf|Adaptation moléculaire]]
+
* [[Media:cours_EM_adapt_mol.pdf|Adaptation moléculaire]]
'''Support TP : '''
'''Support TP : '''
* [[silico:enseignement/m1-mabs/EvolMol/TD1/index.html|tutorial TP1 et TP2]]
* [[silico:enseignement/m1-mabs/EvolMol/TD1/index.html|tutorial TP1 et TP2]]
* [[Media:Introduction_competence_2017.pdf|Petit topo d'introduction sur la régulation de la compétence chez ''S. pneumoniae'']]
* [[Media:Introduction_competence_2017.pdf|Petit topo d'introduction sur la régulation de la compétence chez ''S. pneumoniae'']]
-
<!--* [[Media:Correction_TP1_TP2_2018.pdf|Correction des TP1 et TP2]]
+
* [[Media:Correction_TP1_TP2_2018.pdf|Correction des TP1 et TP2]]
-
* [[Media:questions_reponses_ComD_ComE_trees_srep.pdf|Questionnaire sur l'analyse des arbres ComE et ComD]]
+
* [[Media:questions_reponses_ComD_ComE_trees_srep_2019.pdf|Questionnaire sur l'analyse des arbres ComE et ComD]]
-
* [[Media:Quiz_arbres_ComE_ComD_reponses.pdf|Correction du questionnaire sur l'analyse des arbres ComE et ComD]] -->
+
* [[Media:questions_reponses_ComD_ComE_trees_2019.pdf|Correction du questionnaire sur l'analyse des arbres ComE et ComD]]
* [[Media:TP3_adaptation_moleculaire.zip|tutorial TP3]]
* [[Media:TP3_adaptation_moleculaire.zip|tutorial TP3]]
Line 353: Line 360:
* [[Media:Introduction_bio_annotation_2018.pdf|Introduction biologique  (Gwennaele Fichant)]]
* [[Media:Introduction_bio_annotation_2018.pdf|Introduction biologique  (Gwennaele Fichant)]]
* [[Media:Annotation1.pdf|Annotation partie 1 (Gwennaele Fichant)]]
* [[Media:Annotation1.pdf|Annotation partie 1 (Gwennaele Fichant)]]
-
* [[Media:Annotation2_v2_2018.pdf|Annotation partie 2 (Gwennaele Fichant)]]
+
* [[Media:annotation2_2019.pdf|Annotation partie 2 (Gwennaele Fichant)]]
* [[Media:motif_profil_2017.pdf|Définition et identification des motifs et profils dans les séquences (cours de L3 Bioanalyse) (Gwennaele Fichant)]]
* [[Media:motif_profil_2017.pdf|Définition et identification des motifs et profils dans les séquences (cours de L3 Bioanalyse) (Gwennaele Fichant)]]
* [[Media:HMM_2017.pdf|Modèle de Markov Caché (HMM) (Gwennaele Fichant)]]  
* [[Media:HMM_2017.pdf|Modèle de Markov Caché (HMM) (Gwennaele Fichant)]]  
Line 359: Line 366:
'''Tutoriels de TP :'''
'''Tutoriels de TP :'''
-
*[[silico:enseignement/m1-bioinfo/BG/TD_annotation/tutorial_annotation_new_NVU.html|Annotation d'un fragment génomique bactérien]]
+
*[[silico:enseignement/m1-bioinfo/BG/TD_annotation/Tutorial_annotation_v1_2019.html|Annotation d'un fragment génomique bactérien]]
<!--*[[silico:enseignement/m1-bioinfo/BG/summary_SignalP.pdf|Petite explication de SignalP]] -->
<!--*[[silico:enseignement/m1-bioinfo/BG/summary_SignalP.pdf|Petite explication de SignalP]] -->
*[[silico:enseignement/m1-bioinfo/BG/TD_HMM/TD_HMM_2017.html| design d'un HMM pour prédire les promoteurs sigma A de B. subtilis]]
*[[silico:enseignement/m1-bioinfo/BG/TD_HMM/TD_HMM_2017.html| design d'un HMM pour prédire les promoteurs sigma A de B. subtilis]]
Line 373: Line 380:
'''Contrôle continu :'''  
'''Contrôle continu :'''  
-
*'''Rapport de TP''' sur le design d'un HMM à rendre au plus tard le '''lundi 22 octobre'''. M'envoyer par courrier le rapport en format pdf ainsi que le fichier en format texte comportant votre modèle avant estimation des probabilités.
+
*'''Rapport de TP''' sur le design d'un HMM à rendre au plus tard le '''lundi 14 octobre'''. M'envoyer par courrier le rapport en format pdf ainsi que le fichier en format texte comportant votre modèle avant estimation des probabilités.
-
* '''Projet annotation''' d'un fragment génomique à remettre au plus tard '''le vendredi 7 décembre'''  
+
* '''Projet annotation''' d'un fragment génomique à remettre au plus tard '''le lundi 9 décembre'''  
-
** '''Description du travail à réaliser dans le fichier ci-joint''' : [[Media:Projet.docx|description du projet]]
+
** '''Description du travail à réaliser dans le fichier ci-joint''' : [[Media:Projet_2019.docx|description du projet]]
-
** '''Description du travail à réaliser pour les parsers dans le fichier ci-joint''' : [[Media:Description_parsers.docx|description des parsers]]
+
** '''Description du travail à réaliser pour les parsers dans le fichier ci-joint''' : [[Media:Description_parsers_2019.docx|description des parsers]]
** '''Annoter une des deux séquences fournies''' : [[Media:seq1-5404.txt|séquence 1]] ou [[Media:seq2-7490.txt|séquence 2]]
** '''Annoter une des deux séquences fournies''' : [[Media:seq1-5404.txt|séquence 1]] ou [[Media:seq2-7490.txt|séquence 2]]
** [[Media:exemple_annotation_EMBL.txt|Exemple d'annotation au format EMBL]]
** [[Media:exemple_annotation_EMBL.txt|Exemple d'annotation au format EMBL]]
 +
<!--* [[silico:enseignement/m1-mabs/BGPG/|Cours et TP]]
<!--* [[silico:enseignement/m1-mabs/BGPG/|Cours et TP]]
* [[M1MABS BGPG Projets|Projets à remettre pour le '''17 mai''']]
* [[M1MABS BGPG Projets|Projets à remettre pour le '''17 mai''']]
Line 508: Line 516:
==== Traitement de graphes et réseaux biologiques (EMBIA1KM) ====
==== Traitement de graphes et réseaux biologiques (EMBIA1KM) ====
-
 
-
<!--
 
-
'''Emploi du temps 2015-16'''
 
-
Les CM ont lieu en salle S20, les TP en salle 4TP4-P1.
 
-
{| class="wikitable"
 
-
!colspan="4"|EDT M1 Traitement de graphes et réseaux biologiques
 
-
|-
 
-
|                    || CM mardi 15h45-17h45 en S20    || TP mercredi 13h30-17h30 en 4TP4-P1
 
-
|-
 
-
| semaine 3 - 18.01    || RB CM1 Intro, notions et définitions ||
 
-
|-
 
-
| semaine 4 - 25.01    || RB CM2 représentation et premiers algo (DFS) ||
 
-
|-
 
-
| semaine 5 - 01.02    || RB CM3 algos (détection de cycles, tri topologique)        || RB TP1 Cytoscape, DFS Python
 
-
|-
 
-
| semaine 6 - 08.02    || RB CM4 algos (BFS, Dijkstra, Floyd-Warshall)        ||
 
-
|-
 
-
| semaine 7 - 15.02    || RB CM5 algos (MST Kruskall et Prim, Marches aléatoires, TribeMCL, Motif / Kavosh)        || RB TP2 BFS, plus courts chemins
 
-
|-
 
-
| semaine 8 - 22.01    || RB CM6 Dessin        ||
 
-
|-
 
-
| semaine 9 - 29.02    ||                      ||  RB TP3 dessin, librairie igraph
 
-
|-
 
-
| semaine 10 - 07.03  || YQ Partitionnement et détection de communautés        || YQ TP4 détection de communautés
 
-
|}
 
-
-->
 
'''Supports de cours'''
'''Supports de cours'''
* [[Media:Traitement_de_graphes_et_reseaux_biologiques.pdf|Support de cours]]
* [[Media:Traitement_de_graphes_et_reseaux_biologiques.pdf|Support de cours]]
 +
* [[Media:Traitement_des_graphes_et_reseaux_biologiques_communautes.pdf‎|Support de cours (communautés)]]
<!--
<!--
* [[Media:Traitement_des_graphes_et_reseaux_biologiques_communautes_v2013.pdf|Support de cours (communautés)]]
* [[Media:Traitement_des_graphes_et_reseaux_biologiques_communautes_v2013.pdf|Support de cours (communautés)]]
 +
-->
-->
-
* [[Media:Traitement_des_graphes_et_reseaux_biologiques_communautes_v2015.pdf‎|Support de cours (communautés)]]
 
-
 
'''Supports de TD/TP:'''  
'''Supports de TD/TP:'''  
-
* [[M1 BBS Graphes TP Visualisation|TP]] Visualisation et exploration de graphes
+
* [[M1 BBS Graphes TP Visualisation|TP1]] Visualisation et exploration de graphes
-
* [[M1 BBS Graphes TP Librairie - Parcours de graphes|TP]] Librairie et parcours de graphes
+
* [[M1 BBS Graphes TP Librairie - Parcours de graphes|TP1-2-3-4]] Librairie et parcours de graphes
-
* [[M1 BBS Graphes TP Librairies R|TP]] Librairies R
+
* [[M1 BBS Graphes TP Librairies R|TP4]] Librairies R
-
* [[M1 BBS Graphes TP Dessin et Introduction iGraph|TP]] Dessin de graphes et initiation à la librairie iGraph
+
* [[M1 BBS Graphes TP Recherche de communautés dans les graphes|TP5]] Recherche de communautés dans les graphes
-
* [[M1 BBS Graphes TP Recherche de communautés dans les graphes|TP]] Recherche de communautés dans les graphes
+
* [[M1 BBS Graphes TP Dessin et Introduction iGraph|TP ancien]] Dessin de graphes et initiation à la librairie iGraph
<!--
<!--
-
'''Projets 2017-18'''
+
'''Projets 2018-19'''
* [[M1 BBS Graphes - Projets|Enoncé du projet]]
* [[M1 BBS Graphes - Projets|Enoncé du projet]]
-->
-->
 +
'''Liens:'''
'''Liens:'''
* [http://cytoscape.org/ Cytoscape] (et [http://cytoscapeweb.cytoscape.org/ Cytoscape Web] mais un peu dépassé maintenant)
* [http://cytoscape.org/ Cytoscape] (et [http://cytoscapeweb.cytoscape.org/ Cytoscape Web] mais un peu dépassé maintenant)
Line 577: Line 560:
* <i>Kavosh: a new algorithm for finding network motifs</i>, Kashani <i>et al.</i>, BMC Bioinformatics, 2009. DOI:10.1186/1471-2105-10-318
* <i>Kavosh: a new algorithm for finding network motifs</i>, Kashani <i>et al.</i>, BMC Bioinformatics, 2009. DOI:10.1186/1471-2105-10-318
* <i>Pathway discovery in metabolic networks by subgraph extraction</i>, Faust <i>et al.</i>, Bioinformatics, 1211-1218, 2010. DOI:10.1093/bioinformatics/btq105
* <i>Pathway discovery in metabolic networks by subgraph extraction</i>, Faust <i>et al.</i>, Bioinformatics, 1211-1218, 2010. DOI:10.1093/bioinformatics/btq105
 +
 +
<!--
 +
'''Emploi du temps 2015-16'''
 +
Les CM ont lieu en salle S20, les TP en salle 4TP4-P1.
 +
{| class="wikitable"
 +
!colspan="4"|EDT M1 Traitement de graphes et réseaux biologiques
 +
|-
 +
|                    || CM mardi 15h45-17h45 en S20    || TP mercredi 13h30-17h30 en 4TP4-P1
 +
|-
 +
| semaine 3 - 18.01    || RB CM1 Intro, notions et définitions ||
 +
|-
 +
| semaine 4 - 25.01    || RB CM2 représentation et premiers algo (DFS) ||
 +
|-
 +
| semaine 5 - 01.02    || RB CM3 algos (détection de cycles, tri topologique)        || RB TP1 Cytoscape, DFS Python
 +
|-
 +
| semaine 6 - 08.02    || RB CM4 algos (BFS, Dijkstra, Floyd-Warshall)        ||
 +
|-
 +
| semaine 7 - 15.02    || RB CM5 algos (MST Kruskall et Prim, Marches aléatoires, TribeMCL, Motif / Kavosh)        || RB TP2 BFS, plus courts chemins
 +
|-
 +
| semaine 8 - 22.01    || RB CM6 Dessin        ||
 +
|-
 +
| semaine 9 - 29.02    ||                      ||  RB TP3 dessin, librairie igraph
 +
|-
 +
| semaine 10 - 07.03  || YQ Partitionnement et détection de communautés        || YQ TP4 détection de communautés
 +
|}
 +
-->
==== Fouille de données (EMBIA2DM) ====
==== Fouille de données (EMBIA2DM) ====
Line 631: Line 640:
'''Projet'''
'''Projet'''
<!-- * [[M1 MABS BBS Data Mining Projet|Enoncé]] du projet -->
<!-- * [[M1 MABS BBS Data Mining Projet|Enoncé]] du projet -->
-
* [[silico:enseignement/m1/datamining/projet/sujet.html|Sujet]] 2017-18
+
* [[silico:enseignement/m1/datamining/projet/sujet.html|Sujet]]
'''Liens'''
'''Liens'''
Line 652: Line 661:
* <i>Data Mining: Concepts and Techniques</i>, J. Han and M. Kamber, 2006.
* <i>Data Mining: Concepts and Techniques</i>, J. Han and M. Kamber, 2006.
* ''GENECODIS: a web-based tool for finding significant concurrent annotations in gene lists'', Carmona-Saez ''et al.'', Genome Biology, 2007.
* ''GENECODIS: a web-based tool for finding significant concurrent annotations in gene lists'', Carmona-Saez ''et al.'', Genome Biology, 2007.
 +
* Petit cours d'autodéfense intellectuelle, Normand Baillargeon, 2006
=== Master 1 - MEEF ===
=== Master 1 - MEEF ===
Line 665: Line 675:
-->
-->
-
'''Supports de Cours :'''
+
 
-
A venir...
+
<!--
<!--
* [[Media:1617_PlantesDomes.pdf|CM Plantes Domestiquees]]
* [[Media:1617_PlantesDomes.pdf|CM Plantes Domestiquees]]
Line 696: Line 705:
-->
-->
===== Atelier système =====
===== Atelier système =====
-
* [[M2BBS - Atelier Système]]  
+
* [[M2BBS - Atelier Système]]
 +
 
 +
==== Atelier Chipseq ====
 +
**[[silico:enseignement/m2BBS/ChipSeq/TP_CHIPSEQ_2019_M2Bioinfo_FolderEtudiants.tar.gz|données TP]]
 +
 
 +
===== Atelier Galaxy =====
 +
 
 +
* http://genoweb.toulouse.inra.fr/~formation/8_Galaxy_Admin/2019/
===== UE Communication =====
===== UE Communication =====
=====liste des publications à présenter en préparation des ateliers:=====
=====liste des publications à présenter en préparation des ateliers:=====
-
'''Chaque publication sera choisie par deux étudiant(e)s. La présentation de la publication est personnelle. Donc chaque personne préparera une présentation powerpoint (ou pdf), diapositives en anglais, de 15 minutes qui sera suivie de 10 minutes de questions. Attention, ne pas oublier de consulter et de récupérer les supplementary data. La présentation devra faire ressortir la problématique abordée (question posée et contexte), la démarche bioinformatique adoptée, les résultats sous forme synthétisée avec choix pertinent des figures pour illustrer votre propos et la conclusion/discussion.
+
'''Chaque publication sera choisie par deux étudiant(e)s. La présentation de la publication est personnelle. Donc chaque personne préparera une présentation powerpoint (ou pdf), diapositives en anglais, de 15 minutes qui sera suivie de 10 minutes de questions. La présentation et les questions se feront en français. Attention, ne pas oublier de consulter et de récupérer les supplementary data. La présentation devra faire ressortir la problématique abordée (question posée et contexte), la démarche bioinformatique adoptée, les résultats sous forme synthétisée avec choix pertinent des figures pour illustrer votre propos et la conclusion/discussion.
'''
'''
Line 711: Line 727:
** Article 1 :  
** Article 1 :  
*** [[Media:GenomeBiol2008.pdf|Model-based Analysis of ChIP-Seq (MACS)]]
*** [[Media:GenomeBiol2008.pdf|Model-based Analysis of ChIP-Seq (MACS)]]
-
*** Supplementary information à récupérer sur http://pubs.rsc.org/en/content/articlelanding/2009/mb/b915913b#!divAbstract
+
*** [[Media:MACS_Sup_data.pdf |Supplementary information]]
** Article 2 :  
** Article 2 :  
*** [[Media:Buenrostro_2018.pdf|Integrated Single-Cell Analysis Maps the Continuous Regulatory Landscape of Human Hematopoietic Differentiation]]
*** [[Media:Buenrostro_2018.pdf|Integrated Single-Cell Analysis Maps the Continuous Regulatory Landscape of Human Hematopoietic Differentiation]]
 +
*** Supplementary information à récupérer sur https://www.sciencedirect.com/science/article/pii/S009286741830446X?via%3Dihub
* '''Atelier Phylogénomique'''
* '''Atelier Phylogénomique'''
** Article 1 :  
** Article 1 :  
-
*** [[Media:Simon_et_al_2017.pdf|Phylogenomics of Rhodobacteraceae reveals evolutionary adaptation to marine and non-marine habitats]]
+
*** [[Media:Thakur_Guttman_2016.pdf| A De-Novo Genome Analysis Pipeline (DeNoGAP) for large-scale comparative prokaryotic genomics studies]]
-
*** Supplementary information à récupérer sur http://www.nature.com/ismej/journal/v11/n6/full/ismej2016198a.html
+
*** Supplementary information à récupérer sur https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-016-1142-2
** Article 2
** Article 2
-
***[[Media:Bruto_et_al_2014.pdf|Analysis of genes contributing to plant-beneficial functions in plant growth-promoting rhizobacteria andrelated Proteobacteria]]
+
***[[Media:Ali_et_al_2019.pdf|Identifying Clusters of High Confidence Homologies in Multiple Sequence Alignments]]
-
***[[Media:Bruto_et_al_2014_supdata.pdf|supplementary information for Analysis of genes...]]
+
 
* '''Atelier Modélisation'''
* '''Atelier Modélisation'''
** Article 1 :
** Article 1 :
-
*** [[Media:Toni_et_al_2011.pdf|From qualitative data to quantitative models: analysis of the phage shock protein stress response in Escherichia coli]]
+
*** [[Media:Weyder_et_al_2018.pdf|Dynamic Modeling of Streptococcus pneumoniae Competence Provides Regulatory Mechanistic Insights Into Its Tight Temporal Regulation]]
-
*** [[Media:2011_Toni_supplement.pdf| supplementary information for From qualitative data to quantitative models...]]
+
*** Supplementary information à récupérer sur https://www.frontiersin.org/articles/10.3389/fmicb.2018.01637/full#supplementary-material
** Article 2 :
** Article 2 :
-
*** [[Media:Haustenne_et_al_2015.pdf|Modeling of the ComRS Signaling Pathway Reveals the Limiting Factors Controlling Competence in Streptococcus thermophilus]]
+
*** [[Media:Li_et_al_2008.pdf|A Quantitative Study of the Division Cycle of Caulobacter crescentus Stalked Cells]]
-
*** [[Media:Haustenne_supdata1.docx| supplementary information 1 for Modeling of the ComRS Signaling...]]
+
*** Supplementary information à récupérer sur https://journals.plos.org/ploscompbiol/article?id=10.1371/journal.pcbi.0040009
-
*** [[Media:Haustenne_supdata2.xlsx| supplementary information f2 or Modeling of the ComRS Signaling...]]
+
 
-
*** [[Media:Haustenne_supdata3.pdf| supplementary information 2 for Modeling of the ComRS Signaling...]]
+
-
** Article 3 :
+
-
*** [[Media:Zhao_2018.pdf|Modelling the skip-and-resurgence of Japanese encephalitis epidemics in Hong Kong]]
+
===== Calendrier des présentations =====
===== Calendrier des présentations =====
Line 739: Line 753:
!colspan="5"|EDT présentation des articles (les noms sont donnés pour rappel mais ordre de passage indifférent sauf Fulya 1ère)
!colspan="5"|EDT présentation des articles (les noms sont donnés pour rappel mais ordre de passage indifférent sauf Fulya 1ère)
|-
|-
-
|lundi 1 octobre 9h30-11h45 :
+
|lundi 23 septembre 9h30-11h30 :
-
|articles Atelier ChipSeq
+
|articles Atelier Métabolomique
-
|article 1 : 9H30-11h00 (Fulya, Pierre-Louis, Coralie)
+
|article 1 : 9H30-11h00 (Juliette, Matthieu, Marine)
-
|article 2 : 11h-11h30 (Callum)
+
|
-
|Commentaires : 11h30-11h45
+
||Commentaires : 11h-11h30
|-
|-
-
|lundi 1 octobre 13h30-15h45 :
+
|lundi 23 septembre 13h30-16h :
-
|articles Atelier Phylogénomique
+
|articles Atelier Modélisation
-
|article 1 : 13H30-14h30 (Manon, Sebastian)
+
|article 1 : 13H30-14h30 (Alex, Soufiane)
-
|article 2 : 14h30-15h30 (Justine, Marie)
+
|article 2 : 14h30-15h30 (Eve, Clara)
-
|Commentaires : 15h30-15h45
+
|Commentaires : 15h30-16h
|-
|-
-
|mardi 2 octobre 9h30-10h45 :  
+
|mardi 24 septembre 9h30-12h :  
-
|article Atelier Métabolomique
+
|article Atelier Phylogénomique
-
|article 1 : 9H30-10h30 (William, Julien)
+
|article 2 : 9H30-10h30 (Tristan, Geoffrey)
-
|
+
|article 1 : 10H30-11h30 (Elise, Chloé)
-
|Commentaires : 10h30-10h45
+
|Commentaires : 11h30-12h
-
|-
+
-
|mardi 2 octobre 10h45-12h00 :
+
-
|article Atelier Modélisation
+
-
|article 3 : 10h45-11h45 (Edi, Chris)
+
-
|
+
-
|Commentaires : 11h45-12h  
+
|-
|-
-
|mardi 2 octobre 13h30-15h35 :
+
|mardi 24 septembre 14h-16h30 :
-
|articles Atelier Modélisation
+
|articles Atelier ChipSeq
-
|article 1 : 13h30-14h30 (Elisabeth, Clément)
+
|article 1 : 14h-15h (Marion, Julien)
-
|article 2 : 14h30-15h30 (Younes, Cyril)
+
|article 2 : 15h-16h (Nicolas, Cheryn)
-
|Commentaires : 15h30-15h45
+
|Commentaires : 16h-16h30
|}
|}
Line 828: Line 836:
'''TP :'''
'''TP :'''
* [[Media:CopasiUserguide-20100803-1.pdf|Copasi user guide]]
* [[Media:CopasiUserguide-20100803-1.pdf|Copasi user guide]]
-
 
*'''TP1 : modeling of the psp response when cell envelop  is damaged'''
*'''TP1 : modeling of the psp response when cell envelop  is damaged'''
Line 838: Line 845:
** [[Media:psp_system_hBCAF.txt|hBCAF data]]
** [[Media:psp_system_hBCAF.txt|hBCAF data]]
** [[Media:psp_system_hBcCcA.txt|hBcAcCc data]]
** [[Media:psp_system_hBcCcA.txt|hBcAcCc data]]
-
 
*'''TP2 : modeling of the repressilator:'''
*'''TP2 : modeling of the repressilator:'''
** [[Media:tp_repressilator_2018.pdf|Short description of the repressilator regulation]]
** [[Media:tp_repressilator_2018.pdf|Short description of the repressilator regulation]]
 +
** [[Media:repressilator_continu_2018_time_serie_500.csv|protein time series data]]
<!-- ** [[Media:constante_stochastique.png|stochastic constant file]]
<!-- ** [[Media:constante_stochastique.png|stochastic constant file]]
** [[Media:constante_continu.png|ODE parameter file]] -->
** [[Media:constante_continu.png|ODE parameter file]] -->
 +
*'''TP3 : modeling phosphate regulation in enterobacteria:'''
 +
** [[Media:TP_phosphate_new_2018.pdf|Short biological description of the phosphate regulation]]
-
*'''TP3 : modeling of the regulation of lactose operon :'''
+
*'''TP4 : modeling of the regulation of lactose operon :'''
** [[Media:operon_lactose_description_2018.pdf|Short biological description of the lactose operon regulation]]
** [[Media:operon_lactose_description_2018.pdf|Short biological description of the lactose operon regulation]]
-
 
+
** [[Media:operon_lac_2018_last.spn|Modèle stochastique corrigé]]
<!-- ** [[Media:constantes_2017.txt|stochastic constant file]]
<!-- ** [[Media:constantes_2017.txt|stochastic constant file]]
** [[Media:Constante_parameter_lactose_stochastique_2017.PNG|screen shot of the constant definition in the model]]-->
** [[Media:Constante_parameter_lactose_stochastique_2017.PNG|screen shot of the constant definition in the model]]-->
-
 
-
*'''TP4 : modeling phosphate regulation in enterobacteria:'''
 
-
** [[Media:TP_phosphate_new.pdf|Short biological description of the phosphate regulation]]
 
=== Master 2 - [http://sciences-vegetales.univ-tlse3.fr/presentation-m2-adam-609174.kjsp?RH=1449138073206&RF=1450299526893 ADAM] (Adaptation, Développement et Amélioration des plantes en présence de Microorganismes)===
=== Master 2 - [http://sciences-vegetales.univ-tlse3.fr/presentation-m2-adam-609174.kjsp?RH=1449138073206&RF=1450299526893 ADAM] (Adaptation, Développement et Amélioration des plantes en présence de Microorganismes)===
Line 860: Line 866:
'''Documents, partie E. Gaulin'''
'''Documents, partie E. Gaulin'''
-
* [[M2R_BV|Clonage in silico]]
+
* [[M2R_ADAM|Clonage in silico_BenchLing]]
 +
* [[M2R_BV|Clonage in silico_pDRAW]]
<!--
<!--
 +
-------------------------------------------------------
 +
'''Examen 2019-2020'''
 +
 +
 +
'''Partie E. Gaulin'''
 +
 +
Veuillez trouver ci-dessous, la séquence fasta de l'ORF du gène X (1 171 bases) que l'on souhaite cloner dans le vecteur pCAMBIA
 +
 +
'''>ORF_X'''
 +
 +
ACTTCCAAATTCTAGTATATGTAATCCTTTT
 +
GTTCGGGTTCATGATCGAATTCCAAAGAGTGGAAAACAAGCAAAAGGTTAAATATACATG
 +
CCATTTTTGGAGCTTTCGAGCTCATAACACAGGTGAGCGCGACGAATGGATCCCTCGCTA
 +
ATAACATCATGGTCGTGGGCGCCGTCCTTGCGGCGCTCGTCGCCGGCGGGTCGTGCGGGC
 +
CCCCGAAGGTGCCACCCGGCCCCAACATCACCACCAACTACAACGGCAAGTGGCTCACCG
 +
CTAGGGCCACCTGGTACGGTCAGCCCAACGGTGCCGGCGCTCCTGACAACGGCGGTGCGT
 +
GCGGGATCAAGAACGTGAACCTGCCACCCTACAGCGGCATGACGGCGTGCGGCAACGTCC
 +
CCATCTTCAAGGACGGCAAGGGCTGCGGCTCATGCTACGAGGTGAGATGCAAGGAAAAAC
 +
CTGAGTGCTCGGGCAATCCAGTCACGGTGTACATCACTGACATGAACTACGAACCTATCG
 +
CTCCCTACCACTTCGACTTGAGCGGCAAGGCCTTCGGCTCCCTGGCAAAGCCCGGGCTCA
 +
ACGACAAGATTCGCCACTGCGGCATCATGGACGTCGAGTTCAGAAGGGTGCGATGCAAGT
 +
ACCCCGCCGGGCAGAAGATCGTGTTCCACATCGAGAAGGGCTGCAACCCCAACTACCTGG
 +
CCGTGCTGGTGAAGTATGTGGCGGACGACGGCGACATCGTGCTGATGGAAATCCAGGACA
 +
AGTTGTCGGCTGAGTGGAAGCCCATGAAGCTCTCTTGGGGCGCCATCTGGAGGATGGACA
 +
CTGCCAAGGCGCTCAAGGGCCCCTTCTCCATCCGCCTCACCAGCGAGTCCGGCAAGAAGG
 +
TCATCGCCAAAGACGTCATCCCGGCGAACTGGAGACCCGATGCCGTCTACACTTCCAACG
 +
TCCAATTTTACGTAACTTTGAATTCCCTTCGATTCATCCGGCACAGCGGGCTATGGACCT
 +
TCAGCAGCAAGCTAATTAAGTTGGCAGCATGCACCGCTAACCTTATATACTACTGAGACT
 +
TCCAAATTCTAGTATATGTAATCCTTTTGTTCGGGTTCATGATCGAATTCCAAAGAGTGG
 +
AAAACAAGCAAAAGGTTAAATATACATGCCATTTTTGGAAGCTTGGCTTTCGAGGGTACC
 +
CCTGATAGTT
 +
 +
 +
'''Partie C. Mathé'''
 +
* [http://genoweb.toulouse.inra.fr/~mathe/M2RBV/Exam_Blast.htm Lien vers un BLAST sauvegardé]
 +
 +
 +
'''Partie C. Albenne'''
 +
 +
*[[Media:PGIP.pdb|Lien vers le PGIP]]
 +
 +
 +
-------------------------------------------
 +
'''Examen 2018-2019'''
'''Examen 2018-2019'''
Line 910: Line 961:
-->
-->
 +
 +
= Culture =
 +
 +
* Une histoire de tout ou presque... Bill Bryson, Payot, coll. "Petite Bibliothèque Payot" n° 851, 2012 (ISBN: 9782228907576)
 +
* Norman Baillargeon - Petit cours d'autodéfense intellectuelle, Éditions Lux, collection Instinct de Liberté, 2005. (ISBN: 2-895960-44-5)
 +
* Faire l'économie de la haine, Alain Deneault, 2018, Ecosociete Eds, coll. Polemos
 +
* Comment tout peut s'effondrer. Petit manuel de collapsologie à l'usage des générations présentes. 2015. Pablo Servigne, :Raphaël Stevens. seuil
 +
* Les sentiers de l'utopie, I. Fremeaux et J. Jordan, 2012.
= F.A.Q. =
= F.A.Q. =

Current revision as of 17:07, 10 October 2019

Contents

Licence 2 et 3 Biologie

Bioinformatique - 2B2M (EDSVB4IM), BCP (EDSVA4HM), BOPE (L2 EDSVC4MM, L3 ELSVC6JM)

Supports de cours

Sujets de TD/TP

BioAnalyse L3 BCP

Planning des Enseignements L3 BCP semestre 6 (ELSV6CM1)

Cours

TPs

Exemples de contrôle continu corrigé

BioAnalyse L3 2B2M

TPs


Licence 3 Biologie des Organismes des populations et Ecosystemes (BOPE)

Du génome à la sélection des plantes (ELSVC5EM)

Initiation à la 'Bioanalyse'


Master

Master 1

Master 1 - Bioinformatique et Biologie des Systèmes + Biologie Végétale ADAM

Génomique Evolutive et Phylogénie

Supports de TD/TP :

Medicago SNPs sequences
Drosophile sequences
Primates lysozymes sequences

Traitement de données biologiques (EMBIA1FM)

Supports de cours :

Supports de TD/TP :


Contrôle continu



Liens

Génétique Evolutive et Quantitative (EMBIA1GM)

Support de cours:

Supports de TD/TP :

Master 1 - Bioinformatique et Biologie des Systèmes + Biotechnologies

Evolution Moléculaire (EMBIA2EM)

Supports de cours :

Support TP :

Support TD :

Exemple CC corrigé :


Master 1 - Bioinformatique et Biologie des Systèmes


Bioinformatique pour la Génomique (EMBIA1DM)

Supports de cours :

Tutoriels de TP :

Aide pour la réalisation du projet annotation

Contrôle continu :

  • Rapport de TP sur le design d'un HMM à rendre au plus tard le lundi 14 octobre. M'envoyer par courrier le rapport en format pdf ainsi que le fichier en format texte comportant votre modèle avant estimation des probabilités.


Mathématique pour la Biologie (EMBIA1EM)

Sujets de TP :

  • TD Calcul matriciel
  • TD ACP
  • TD Modélisation
  • TD Probabilités

Exam TP

Liens :

  • http://exercism.io : améliorer son niveau de programmation dans différents langages (notamment R)

Références

  • Mathématiques pour les Sciences de la vie et de la Terre – C. David, S. Mustapha, F. Viens, N. Capron, edition Dunod

Projet 2018-19:





Traitement de graphes et réseaux biologiques (EMBIA1KM)

Supports de cours

Supports de TD/TP:

  • TP1 Visualisation et exploration de graphes
  • TP1-2-3-4 Librairie et parcours de graphes
  • TP4 Librairies R
  • TP5 Recherche de communautés dans les graphes
  • TP ancien Dessin de graphes et initiation à la librairie iGraph


Liens:

Références

  • Introduction to Algorithms, Corsen, Leiserson and Rivest, MIT Press and McGraw-Hill
  • Detection of Functional Modules From Protein Interaction Networks, Pereira-Leal, Enright and Ozounis, PROTEINS: Structure, Function, and Bioinformatics, 49-57, 2004.
  • An efficient algorithm for large-scale detection of protein families, Enright, Van Dongen and Ozounis, Nucleic Acids Research, 1575-84, 2002 PMID:11917018
  • Kavosh: a new algorithm for finding network motifs, Kashani et al., BMC Bioinformatics, 2009. DOI:10.1186/1471-2105-10-318
  • Pathway discovery in metabolic networks by subgraph extraction, Faust et al., Bioinformatics, 1211-1218, 2010. DOI:10.1093/bioinformatics/btq105


Fouille de données (EMBIA2DM)

Support de cours:

Sujets de TD/TP

  • TD Classification, validation croisée et clustering

Projet

Liens

Références

  • Data Mining: Concepts and Techniques, J. Han and M. Kamber, 2006.
  • GENECODIS: a web-based tool for finding significant concurrent annotations in gene lists, Carmona-Saez et al., Genome Biology, 2007.
  • Petit cours d'autodéfense intellectuelle, Normand Baillargeon, 2006

Master 1 - MEEF

Sciences de la Vie (EE7BSVFM)

Supports de TD :


Master 2

Master 2P Diagnostic moléculaire en microbiolgy

Supports de cours
Tutoriels de TP

Master 2 - Bioinformatique et Biologie des Systèmes

Atelier système

Atelier Chipseq

Atelier Galaxy
UE Communication
liste des publications à présenter en préparation des ateliers:

Chaque publication sera choisie par deux étudiant(e)s. La présentation de la publication est personnelle. Donc chaque personne préparera une présentation powerpoint (ou pdf), diapositives en anglais, de 15 minutes qui sera suivie de 10 minutes de questions. La présentation et les questions se feront en français. Attention, ne pas oublier de consulter et de récupérer les supplementary data. La présentation devra faire ressortir la problématique abordée (question posée et contexte), la démarche bioinformatique adoptée, les résultats sous forme synthétisée avec choix pertinent des figures pour illustrer votre propos et la conclusion/discussion.


Calendrier des présentations
EDT présentation des articles (les noms sont donnés pour rappel mais ordre de passage indifférent sauf Fulya 1ère)
lundi 23 septembre 9h30-11h30 : articles Atelier Métabolomique article 1 : 9H30-11h00 (Juliette, Matthieu, Marine) Commentaires : 11h-11h30
lundi 23 septembre 13h30-16h : articles Atelier Modélisation article 1 : 13H30-14h30 (Alex, Soufiane) article 2 : 14h30-15h30 (Eve, Clara) Commentaires : 15h30-16h
mardi 24 septembre 9h30-12h : article Atelier Phylogénomique article 2 : 9H30-10h30 (Tristan, Geoffrey) article 1 : 10H30-11h30 (Elise, Chloé) Commentaires : 11h30-12h
mardi 24 septembre 14h-16h30 : articles Atelier ChipSeq article 1 : 14h-15h (Marion, Julien) article 2 : 15h-16h (Nicolas, Cheryn) Commentaires : 16h-16h30
Intégration de Données Hétérogènes - Partie R. Barriot
Atelier Génétique Satistique - S. Boitard

Support de cours et TD:

TP :

Atelier Phylogénomique

Intervenants : Hélène Chiapello, Kathy.De-Sousa, Claire Hoede et Yves Quentin

Atelier de Phylogénomique

Biologie des Systèmes - R. Barriot


Biologie des Systèmes - G. Czaplicki

Fichiers avec les codes :

Biologie des Systèmes - G. Fichant

Support de cours:


TP :

Master 2 - ADAM (Adaptation, Développement et Amélioration des plantes en présence de Microorganismes)

Biologie Computationnelle

Documents, partie E. Gaulin


Culture

  • Une histoire de tout ou presque... Bill Bryson, Payot, coll. "Petite Bibliothèque Payot" n° 851, 2012 (ISBN: 9782228907576)
  • Norman Baillargeon - Petit cours d'autodéfense intellectuelle, Éditions Lux, collection Instinct de Liberté, 2005. (ISBN: 2-895960-44-5)
  • Faire l'économie de la haine, Alain Deneault, 2018, Ecosociete Eds, coll. Polemos
  • Comment tout peut s'effondrer. Petit manuel de collapsologie à l'usage des générations présentes. 2015. Pablo Servigne, :Raphaël Stevens. seuil
  • Les sentiers de l'utopie, I. Fremeaux et J. Jordan, 2012.

F.A.Q.

  • Installation de igraph sur CentOS 6.7 en P0

Sous R, l'installation d'igraph échoue avec le protocole https, il faut donc choisir un mirroir avec le protocol http : choseCRANmirror() dernier choix (http mirrors) puis Lyon2

R> chooseCRANmirror()
R> install.packages('igraph')


  • Installation de Rstudio sur CentOS 6.7 en P0

La dernière version de Rstudio desktop ne fonctionne pas pour CentOS6.7 (nécessite des librairies plus récentes). Il faut donc télécharger et installer la version serveur :

# Dans un terminal, passer root (super-utilisateur)
bash> su
# puis les commandes ci-dessous (sans le "root>")
root> wget https://download2.rstudio.org/rstudio-server-rhel-0.99.892-x86_64.rpm
root> yum install --nogpgcheck rstudio-server-rhel-0.99.892-x86_64.rpm

Ensuite, on accède à l'interface avec le navigateur : http://localhost:8787 avec un compte de la machine (normalement le compte guest)