silico.biotoul.fr
 

Enseignements

From silico.biotoul.fr

(Difference between revisions)
Jump to: navigation, search
m (Mathématique pour la Biologie (EMBIA1EM))
m (Mathématique pour la Biologie (EMBIA1EM))
Line 451: Line 451:
'''Projet 2020-21 :'''
'''Projet 2020-21 :'''
* [[silico:enseignement/m1/math/projet/M1BBS_Math_Sujet_Projet_2020-21.html|Sujet du projet 2020-21]]
* [[silico:enseignement/m1/math/projet/M1BBS_Math_Sujet_Projet_2020-21.html|Sujet du projet 2020-21]]
-
* Choix d'un graphe pour le projet (ne pas prendre un graphe déjà choisi par quelqu'un d'autre) : https://framadate.org/M1BBS-Projet-Math
+
<!-- * Choix d'un graphe pour le projet (ne pas prendre un graphe déjà choisi par quelqu'un d'autre) : https://framadate.org/M1BBS-Projet-Math -->
* Les projets sont à rendre '''avant''' les fêtes de fin d'année
* Les projets sont à rendre '''avant''' les fêtes de fin d'année
* Graphe à analyser
* Graphe à analyser
-
*# [[silico:enseignement/m1/math/projet/g1.gr|graphe 1]]
+
*# [[silico:enseignement/m1/math/projet/g1.gr|graphe 1]] Gabryelle
-
*# [[silico:enseignement/m1/math/projet/g2.gr|graphe 2]]
+
*# [[silico:enseignement/m1/math/projet/g2.gr|graphe 2]] Marine
-
*# [[silico:enseignement/m1/math/projet/g3.gr|graphe 3]]
+
*# [[silico:enseignement/m1/math/projet/g3.gr|graphe 3]] Etienne
-
*# [[silico:enseignement/m1/math/projet/g4.gr|graphe 4]]
+
*# [[silico:enseignement/m1/math/projet/g4.gr|graphe 4]] Hugo
-
*# [[silico:enseignement/m1/math/projet/g5.gr|graphe 5]]
+
*# [[silico:enseignement/m1/math/projet/g5.gr|graphe 5]] Lou
-
*# [[silico:enseignement/m1/math/projet/g6.gr|graphe 6]]
+
*# [[silico:enseignement/m1/math/projet/g6.gr|graphe 6]] Victoria
-
*# [[silico:enseignement/m1/math/projet/g7.gr|graphe 7]]
+
*# [[silico:enseignement/m1/math/projet/g7.gr|graphe 7]] Nadine
-
*# [[silico:enseignement/m1/math/projet/g8.gr|graphe 8]]
+
*# [[silico:enseignement/m1/math/projet/g8.gr|graphe 8]] Antoine
-
*# [[silico:enseignement/m1/math/projet/g9.gr|graphe 9]]
+
*# [[silico:enseignement/m1/math/projet/g9.gr|graphe 9]] Romane
-
*# [[silico:enseignement/m1/math/projet/g10.gr|graphe 10]]
+
*# [[silico:enseignement/m1/math/projet/g10.gr|graphe 10]] Julien
-
*# [[silico:enseignement/m1/math/projet/g11.gr|graphe 11]]
+
*# [[silico:enseignement/m1/math/projet/g11.gr|graphe 11]] Wanxing
-
*# [[silico:enseignement/m1/math/projet/g12.gr|graphe 12]]
+
*# [[silico:enseignement/m1/math/projet/g12.gr|graphe 12]] Oussama
-
*# [[silico:enseignement/m1/math/projet/g13.gr|graphe 13]]
+
*# [[silico:enseignement/m1/math/projet/g13.gr|graphe 13]] Sandro
-
*# [[silico:enseignement/m1/math/projet/g14.gr|graphe 14]]
+
*# [[silico:enseignement/m1/math/projet/g14.gr|graphe 14]] Mathias
-
*# [[silico:enseignement/m1/math/projet/g15.gr|graphe 15]]
+
*# [[silico:enseignement/m1/math/projet/g15.gr|graphe 15]] Natacha
-
*# [[silico:enseignement/m1/math/projet/g16.gr|graphe 16]]
+
*# [[silico:enseignement/m1/math/projet/g16.gr|graphe 16]] Nolan
-
*# [[silico:enseignement/m1/math/projet/g17.gr|graphe 17]]
+
*# [[silico:enseignement/m1/math/projet/g17.gr|graphe 17]] Sophia
-
*# [[silico:enseignement/m1/math/projet/g18.gr|graphe 18]]
+
*# [[silico:enseignement/m1/math/projet/g18.gr|graphe 18]] Ludovic
-
*# [[silico:enseignement/m1/math/projet/g19.gr|graphe 19]]
+
*# [[silico:enseignement/m1/math/projet/g19.gr|graphe 19]] Maina
-
*# [[silico:enseignement/m1/math/projet/g20.gr|graphe 20]]
+
*# [[silico:enseignement/m1/math/projet/g20.gr|graphe 20]] Jeanne
*# [[silico:enseignement/m1/math/projet/g21.gr|graphe 21]]
*# [[silico:enseignement/m1/math/projet/g21.gr|graphe 21]]
*# [[silico:enseignement/m1/math/projet/g22.gr|graphe 22]]
*# [[silico:enseignement/m1/math/projet/g22.gr|graphe 22]]

Revision as of 08:56, 19 October 2020


Contents

Licence 2 et 3 Biologie

Bioinformatique - Option L2-L3 2B2M-BCP-BOPE

UE en option avec différents codes :

  • L2 2B2M : EDSVB4IM
  • L2 BCP : EDSVA4HM
  • L2 BOPE : EDSVC4MM
  • L3 BOPE : ELSVC6JM

Emploi du temps 2019-20

Aussi disponible sur https://calendar.google.com/calendar/embed?src=lic.bioinfo%40gmail.com&ctz=Europe/Paris


Les groupes de TD et TP 2019-20 sont disponibles sur moodle : https://moodle.univ-tlse3.fr/course/view.php?id=2518


EDT L2-L3 2B2M-BCP-BOPE Bioinformatique
CM 3TP2-Einstein TD TP
semaine 04 - 20/01 13h30-15h40 R. Barriot Bioinfo générale
semaine 05 - 27/01 13h30-15h40 F. Delavoie Imagerie 15h50-18h00 groupes gTP1 en 4TP4-P1 & gTP2 en 4TP4-P15
18h10-20h20 groupe gTP3 en 4TP2-M6
semaine 06 - 03/02 13h30-15h40 R. Barriot Bases de Données 15h50-18h00 U2-116 groupe gTD1
18h10-20h20 U2-116 groupe gTD2
semaine 07 - 10/02 13h30-15h40 groupe gTP1 en 4TP2-M7
15h50-18h00 groupe gTP2 en 4TP4-P15
18h10-20h20 groupe gTP3 en 4TP2-M6
semaine 08 - 17/02
semaine 09 - 24/02 13h30-15h40 M. Bonhomme 15h50-18h00 groupes gTP1 en 4TP4-P1 & gTP2 en 4TP4-P15
18h10-20h20 groupe gTP3 en 4TP2-M6
semaine 10 - 02/03 13h30-15h30 Contrôle continu en 4A-Leclerc
semaine 11 - 09/03 13h30-15h40 G. Fichant SysBio 15h50-18h00 groupes gTP1 en 4TP4-P1 & gTP2 en 4TP4-P15
18h10-20h20 groupe gTP3 en 4TP2-M6
semaine 12 - 16/03 13h30-15h40 gTD1 en U2-220
15h50-18h00 gTD2 en U2-219
semaine 13 - 23/03 13h30-15h40 groupe gTP1 en 4TP2-M7
15h50-18h00 groupe gTP2 en 4TP4-P15
18h10-20h20 groupe gTP3 en 4TP2-M6
semaine 14 - 30/03 13h30-15h30 Contrôle terminal anticipé en Eintein





Supports de cours

Sujets de TD/TP

BioAnalyse L3 BCP

Planning des Enseignements L3 BCP semestre 6 (ELSV6CM1)

Cours

TPs

Exemples de contrôle continu corrigé

BioAnalyse L3 2B2M

TPs

Licence 3 Biologie des Organismes des populations et Ecosystemes (BOPE)

Du génome à la sélection des plantes (ELSVC5EM)

Initiation à la 'Bioanalyse'


Master

Master 1

Master 1 - Bioinformatique et Biologie des Systèmes + Biologie Végétale ADAM

Génomique Evolutive et Phylogénie

Supports de TD/TP :

Medicago SNPs sequences
Drosophile sequences
Primates lysozymes sequences

Traitement de données biologiques (EMBIA1FM)

Supports de cours :

Supports de TD/TP :


Liens

Génétique Evolutive et Quantitative (EMBIA1GM)

Support de cours:

Supports de TD/TP :

Master 1 - Bioinformatique et Biologie des Systèmes + Biotechnologies

Evolution Moléculaire (EMBIA2EM)

Supports de cours :

Support TP :

Support TD :

Exemple CC corrigé :


Master 1 - Bioinformatique et Biologie des Systèmes


Bioinformatique pour la Génomique (EMBIA1DM)

Supports de cours :

Tutoriels de TP :

Aide pour la réalisation du projet annotation

Contrôle continu :

  • Rapport de TP sur le design d'un HMM à rendre au plus tard le lundi 12 octobre. M'envoyer par courrier le rapport en format pdf ainsi que le fichier en format texte comportant votre modèle avant estimation des probabilités et celui après estimation des probabilités.


Mathématique pour la Biologie (EMBIA1EM)

Sujets de TP :

  • TD Calcul matriciel
  • TD ACP
  • TD Modélisation
  • TD Probabilités


Liens :

  • http://exercism.io : améliorer son niveau de programmation dans différents langages (notamment R)

Références

  • Mathématiques pour les Sciences de la vie et de la Terre – C. David, S. Mustapha, F. Viens, N. Capron, edition Dunod

Projet 2020-21 :





Traitement de graphes et réseaux biologiques (EMBIA1KM)

Supports de cours

Supports de TD/TP:

  • TP1 Visualisation et exploration de graphes
  • TP1-2-3-4 Librairie et parcours de graphes
  • TP4 Librairies R
  • TP5 Recherche de communautés dans les graphes
  • TP archivé Dessin de graphes et initiation à la librairie iGraph


Projets 2019-20


Liens: Logiciels

Librairies

Serveurs & Banques

Formats

Autres

Références

  • Introduction to Algorithms, Corsen, Leiserson and Rivest, MIT Press and McGraw-Hill
  • Detection of Functional Modules From Protein Interaction Networks, Pereira-Leal, Enright and Ozounis, PROTEINS: Structure, Function, and Bioinformatics, 49-57, 2004.
  • An efficient algorithm for large-scale detection of protein families, Enright, Van Dongen and Ozounis, Nucleic Acids Research, 1575-84, 2002 PMID:11917018
  • Kavosh: a new algorithm for finding network motifs, Kashani et al., BMC Bioinformatics, 2009. DOI:10.1186/1471-2105-10-318
  • Pathway discovery in metabolic networks by subgraph extraction, Faust et al., Bioinformatics, 1211-1218, 2010. DOI:10.1093/bioinformatics/btq105


Fouille de données (EMBIA2DM)

Support de cours:

Sujets de TD/TP

  • TD Classification, validation croisée et clustering

Projet


Liens

Références

  • Data Mining: Concepts and Techniques, J. Han and M. Kamber, 2006.
  • GENECODIS: a web-based tool for finding significant concurrent annotations in gene lists, Carmona-Saez et al., Genome Biology, 2007.
  • Petit cours d'autodéfense intellectuelle, Normand Baillargeon, 2006

Master 1 - MEEF

Sciences de la Vie (EE7BSVFM)

Supports de TD :


Master 2

Master 2P Diagnostic moléculaire en microbiolgy

Supports de cours
Tutoriels de TP

Master 2 - Bioinformatique et Biologie des Systèmes

Atelier système

Atelier Chipseq

Atelier Galaxy

UE Communication

liste des publications à présenter en préparation des ateliers:

Chaque publication sera choisie par deux étudiant(e)s. La présentation de la publication est personnelle. Donc chaque personne préparera une présentation powerpoint (ou pdf), diapositives en anglais, de 15 minutes qui sera suivie de 10 minutes de questions. La présentation et les questions se feront en français. Attention, ne pas oublier de récupérer et de lire les supplementary data qui sont aussi important pour la compréhension de l'article. La présentation devra faire ressortir la problématique abordée (question posée et contexte), la démarche bioinformatique adoptée, les résultats sous forme synthétisée avec choix pertinent des figures pour illustrer votre propos et la conclusion/discussion.

Calendrier des présentations d'articles
EDT présentation des articles (les noms sont donnés pour rappel mais ordre de passage indifférent)
lundi 28 septembre 9h30-12h : articles Atelier Phylogénomique article 1 : 9H30-10h30 (Codé, Laura D) article 2 : 10h40-11h40 (Laura B, Tomas) Commentaires : 11h40-12h
lundi 28 septembre 13h45-16h15 : articles Atelier Modélisation article 1 : 13H45-14h45 (Alexia, Aurélien) article 2 : 14h55-15h55 (Pierre, Safia) Commentaires : 15h55-16h15
mardi 29 septembre 9h30-12h : article Atelier Métabolomique article 1 : 9H30-10h30 (Baptiste, Quentin) article 2 : 10H40-11h40 (Antoine, Sophie) Commentaires : 11h40-12h
mardi 28 septembre 13h45-16h15 : articles Atelier ChipSeq article 1 : 13h45-14h45 (Jérémy, Valentine) article 2 : 14h55-15h55 (Houyem, Refka) Commentaires : 15h55-16h15

Intégration de Données Hétérogènes - Partie R. Barriot


Atelier Phylogénomique

Intervenants : Claire Hoede et Yves Quentin

Atelier de Phylogénomique


Biologie des Systèmes - G. Czaplicki

Fichiers avec les codes :

Biologie des Systèmes - G. Fichant

Support de cours:


TP :





Master 2 - ADAM (Adaptation, Développement et Amélioration des plantes en présence de Microorganismes)

Biologie Computationnelle

Documents, partie E. Gaulin




Examen 2020-2021


Partie E. Gaulin

Veuillez trouver ci-dessous, la séquence fasta de l'ADNc PEP2 du champignon que l'on souhaite cloner dans le vecteur de destination pCAMBIA

>ADNc_PEP2

ACTTCCAAATTCTAGTATATGTAATCCTTTT GTTCGGGTTCATGATCGAATTCCAAAGAGTGGAAAACAAGCAAAAGGTTAAATATACATG CCATTTTTGGAGCTTTCGAGCTCATAACACAGGTGAGCGCGACGAATGGATCCCTCGCTA ATAACATCATGGTCGTGGGCGCCGTCCTTGCGGCGCTCGTCGCCGGCGGGTCGTGCGGGC CCCCGAAGGTGCCACCCGGCCCCAACATCACCACCAACTACAACGGCAAGTGGCTCACCG CTAGGGCCACCTGGTACGGTCAGCCCAACGGTGCCGGCGCTCCTGACAACGGCGGTGCGT GCGGGATCAAGAACGTGAACCTGCCACCCTACAGCGGCATGACGGCGTGCGGCAACGTCC CCATCTTCAAGGACGGCAAGGGCTGCGGCTCATGCTACGAGGTGAGATGCAAGGAAAAAC CTGAGTGCTCGGGCAATCCAGTCACGGTGTACATCACTGACATGAACTACGAACCTATCG CTCCCTACCACTTCGACTTGAGCGGCAAGGCCTTCGGCTCCCTGGCAAAGCCCGGGCTCA ACGACAAGATTCGCCACTGCGGCATCATGGACGTCGAGTTCAGAAGGGTGCGATGCAAGT ACCCCGCCGGGCAGAAGATCGTGTTCCACATCGAGAAGGGCTGCAACCCCAACTACCTGG CCGTGCTGGTGAAGTATGTGGCGGACGACGGCGACATCGTGCTGATGGAAATCCAGGACA AGTTGTCGGCTGAGTGGAAGCCCATGAAGCTCTCTTGGGGCGCCATCTGGAGGATGGACA CTGCCAAGGCGCTCAAGGGCCCCTTCTCCATCCGCCTCACCAGCGAGTCCGGCAAGAAGG TCATCGCCAAAGACGTCATCCCGGCGAACTGGAGACCCGATGCCGTCTACACTTCCAACG TCCAATTTTACGTAACTTTGAATTCCCTTCGATTCATCCGGCACAGCGGGCTATGGACCT TCAGCAGCAAGCTAATTAAGTTGGCAGCATGCACCGCTAACCTTATATACTACTGAGACT TCCAAATTCTAGTATATGTAATCCTTTTGTTCGGGTTCATGATCGAATTCCAAAGAGTGG AAAACAAGCAAAAGGTTAAATATACATGCCATTTTTGGAAGCTTGGCTTTCGAGGGTACC CCTGATAGTT


Partie C. Mathé


Partie C. Albenne



Culture

  • Une histoire de tout ou presque... Bill Bryson, Payot, coll. "Petite Bibliothèque Payot" n° 851, 2012 (ISBN: 9782228907576)
  • Norman Baillargeon - Petit cours d'autodéfense intellectuelle, Éditions Lux, collection Instinct de Liberté, 2005. (ISBN: 2-895960-44-5)
  • Faire l'économie de la haine, Alain Deneault, 2018, Ecosociete Eds, coll. Polemos
  • Comment tout peut s'effondrer. Petit manuel de collapsologie à l'usage des générations présentes. 2015. Pablo Servigne, :Raphaël Stevens. seuil
  • Les sentiers de l'utopie, I. Fremeaux et J. Jordan, 2012.

F.A.Q.

  • Installation de igraph sur CentOS 6.7 en P0

Sous R, l'installation d'igraph échoue avec le protocole https, il faut donc choisir un mirroir avec le protocol http : choseCRANmirror() dernier choix (http mirrors) puis Lyon2

R> chooseCRANmirror()
R> install.packages('igraph')


  • Installation de Rstudio sur CentOS 6.7 en P0

La dernière version de Rstudio desktop ne fonctionne pas pour CentOS6.7 (nécessite des librairies plus récentes). Il faut donc télécharger et installer la version serveur :

# Dans un terminal, passer root (super-utilisateur)
bash> su
# puis les commandes ci-dessous (sans le "root>")
root> wget https://download2.rstudio.org/rstudio-server-rhel-0.99.892-x86_64.rpm
root> yum install --nogpgcheck rstudio-server-rhel-0.99.892-x86_64.rpm

Ensuite, on accède à l'interface avec le navigateur : http://localhost:8787 avec un compte de la machine (normalement le compte guest)