TD2 Genome Selection Plantes


(Difference between revisions)
Jump to: navigation, search
(Exercice 3 : Comparaison de plusieurs séquences par alignement multiple)
(Exercice 1 : Comparaison de 2 séquences avec une matrice de point (dot plot))
(28 intermediate revisions not shown)
Line 1: Line 1:
'''== RAPPEL / Controle Continu, Mercedi 13 Decembre 13h30 en U1 MATHIS ==
Ce TD a pour but d'apprendre a comparer des séquences deux a deux via différentes methodes (matrice de point, alignement global et local), à definir des signatures protéqiues après utilisation d'alignement multiple, a mettre en application votre savoir-faire !
Ce TD a pour but d'apprendre a comparer des séquences deux a deux via différentes methodes (matrice de point, alignement global et local), à definir des signatures protéiques après utilisation d'alignement multiple, a mettre en application votre savoir-faire !
Quelques liens utiles:
*[ NCBI]
*[ EBI - European Bioinformatics Institute]
== Exercice 1 : Comparaison de 2 séquences avec une matrice de point (dot plot) ==
== Exercice 1 : Comparaison de 2 séquences avec une matrice de point (dot plot) ==
Line 15: Line 15:
* Comparer les séquences deux à deux, en utilisant une matrice de point (dotplot).  
* Comparer les séquences deux à deux, en utilisant une matrice de point (dotplot).  
Les logiciels sont disponibles dans la suite EMBOSS [ de la Genopole de Toulouse] ou du centre de [  Bioinformatique des Pays Bas]
Les logiciels sont disponibles dans la suite EMBOSS [ de la Genopole de Toulouse] ou du centre de [  Bioinformatique des Pays Bas]
:Utiliser '''DOTPATH''' qui permet de dessiner un '''dotplot''' avec une taille de mot fixée.
:Utiliser '''DOTPATH''' qui permet de dessiner un '''dotplot''' avec une taille de mot fixée et visualiser des diagonales 'd'identité'
:Faites la même analyse avec '''DOTMATCHER''' en gardant les paramètres par défaut, et qui permet de visualiser des diagnonales de 'similarité'
:Que pouvez-vous conclure ?
:Que pouvez-vous conclure ?
Line 50: Line 51:
L'idée maintenant est de comparer plusieurs séquences similaires entre elles, afin par exemple d'en définir les liens évolutifs ou d'identifier des 'zones' (motifs/domaines) conservés pouvant décrire la famille protéique
L'idée maintenant est de comparer plusieurs séquences similaires entre elles, afin par exemple d'en définir les liens évolutifs ou d'identifier des 'zones' (motifs/domaines) conservés pouvant décrire la famille protéique
* Dans la banque de données UniProt/SwissProt, identifiez les séquences protéiques "THAP" de l'homme, la souris, le poulet et le zebrafish. Eliminez les séquences isoformes 2 et 3.  
* Dans la banque de données UniProt/SwissProt au NCBI, identifiez les séquences protéiques "THAP" de l'homme, la souris, le poulet et le zebrafish. Eliminez les séquences isoformes 2 et 3.  
* Récupérez l'ensemble des séquences dans un fichier au format Fasta
* Récupérez l'ensemble des séquences dans un fichier au format Fasta
* Réalisez un alignement de l'ensemble des séquences (=alignement multiple) en utilisant Clustal Omega disponible a [ l'EBI] (>Services)
* Réalisez un alignement de l'ensemble des séquences (=alignement multiple) en utilisant Clustal Omega disponible a [ l'EBI] (>Services)
* Trouvez-vous des 'zones similaires' (=domaines) à l'ensemble de ces séquences.  
* Trouvez-vous des 'zones similaires' (=domaines) à l'ensemble de ces séquences.  
''NB : Le motif  'AVPTIF' marque la fin du domaine : le trouvez-vous sur toutes les séquences ?''
'''''NB : Le motif  'AVPTIF' marque une partie du domaine : le trouvez-vous sur toutes les séquences ?'''''
Nous allons maintenant essayer de construire un pattern/signature caractéristique de cette famille de protéine en sebasant sur les 'zones similaires' préalablement identifiées
Nous allons maintenant essayer de construire un pattern/signature caractéristique de cette famille de protéine en sebasant sur les 'zones similaires' préalablement identifiées
*Construire une signature PROSITE à partir de votre alignement (n'utilisez pas le LOGO, sinon vous ne voyez pas précisément les zones de gap)
*Construire une signature PROSITE à partir de votre alignement (n'utilisez pas le LOGO, sinon vous ne voyez pas précisément les zones de gap)
     Pour vous aider, voici le début d'une signature (ou ''pattern'') : '''Q-L-x(3)-P-x(6)-[FY]-x(2)-V-x(3)-[LVF]-[FGD]-x(2,8)-[GPS]'''
     Voici l'exemple d'un début d'une signature (ou ''pattern'') : '''Q-L-x(3)-P-x(6)-[FY]-x(2)-V-x(3)-[LVF]-[FGD]-x(2,8)-[GPS]'''
Comment lire cette signature ? <br>
Vous avez probablement quelque chose d'approchant dans votre alignement, traduisant que :<br>
    Q-L : il n'y a que les acides aminés Q puis L dans 2 colonnes successives de l'alignement <br>
    x(3) : 3 colonnes avec des acides aminés variables <br>
:Q-L : il n'y a que les acides aminés Q puis L dans 2 colonnes successives de l'alignement <br>
    [FY] : dans cette colonne seuls les acides aminés F ou Y sont présents <br>
:x(3) : 3 colonnes avec des acides aminés variables <br>
    x(2,8) : zone avec un gap. Entre 2 et 8 résidus (acides aminés) quelconques, suivant les séquences <br>
:[FY] : dans cette colonne seuls les acides aminés F ou Y sont présents <br>
:x(2,8) : zone avec un gap. Entre 2 et 8 résidus (acides aminés) quelconques, suivant les séquences <br>
*Tester la spécificité de votre signature sur [ '''ScanProsite'''] (choisir l'option 2) contre SwissProt ou trEMBL (plus long !) <br>
*Tester la spécificité de votre signature sur [ '''ScanProsite'''] (choisir l'option 2) contre SwissProt ou trEMBL (plus long !) <br>
Line 161: Line 160:
Répondez aux questions suivantes:'''
Répondez aux questions suivantes:'''
Line 171: Line 172:
* exite-t-il des domaines conservés dans cette protéine?  
* exite-t-il des domaines conservés dans cette protéine?  
Sauvegardez la séquence de l'ARNm et du gène au format fasta
Sauvegardez la séquence de l'ARNm et du gène au format fasta
* sans tenir compte des informations disponibles dans la fiche GenPept, identifiez le nombre d'introns/exons dans le gène codant cette protéine... peut etre par Dot Plot...
* sans tenir compte des informations disponibles dans la fiche GenPept, identifiez le nombre d'introns/exons dans le gène codant cette protéine... peut etre par Dot Plot...

Current revision as of 15:02, 3 December 2018



Ce TD a pour but d'apprendre a comparer des séquences deux a deux via différentes methodes (matrice de point, alignement global et local), à definir des signatures protéiques après utilisation d'alignement multiple, a mettre en application votre savoir-faire !

Quelques liens utiles:

Exercice 1 : Comparaison de 2 séquences avec une matrice de point (dot plot)

  • Rechercher les 2 séquences enregistrées sous les numéros d'accession P10415 et Q64373
  • Que pouvez vous dire sur ces 2 séquences ?
  • Comparer les séquences deux à deux, en utilisant une matrice de point (dotplot).

Les logiciels sont disponibles dans la suite EMBOSS de la Genopole de Toulouse ou du centre de Bioinformatique des Pays Bas

Utiliser DOTPATH qui permet de dessiner un dotplot avec une taille de mot fixée et visualiser des diagonales 'd'identité'
Faites la même analyse avec DOTMATCHER en gardant les paramètres par défaut, et qui permet de visualiser des diagnonales de 'similarité'
Que pouvez-vous conclure ?

Exercice 2: Comparaison de 2 séquences par alignement global et local : Cas d'Ecole

Voici 2 séquences, au format FASTA :





  • Faites un dotplot de ces 2 séquences : qu'observez-vous ?
  • Faites un alignement global (de bout à bout) entre les 2 séquences avec Stretcher disponible sur EMBOSS
Qu'observez vous ?
Combien y a-t-il de gaps ? A quoi correspondent-ils ?
A quoi correspond le pourcentage de similarité ?
Quels sont les paramètres de calcul du score ?
Votre alignement est-il significatif ?
  • Faites un alignement local avec Matcher disponible sur EMBOSS.

NB: dans 'alternative matches' indiquez 10, de façon a visualiser 10 alignements locaux

Qu'observez-vous ?
Regardez les autres alignements locaux. Sont-il significatifs ?

NB: si vous avez besoin de convertir vos séquences au Format Fasta un petit outil bien utile  :ReadSeq

Exercice 3 : Comparaison de plusieurs séquences par alignement multiple

L'idée maintenant est de comparer plusieurs séquences similaires entre elles, afin par exemple d'en définir les liens évolutifs ou d'identifier des 'zones' (motifs/domaines) conservés pouvant décrire la famille protéique

  • Dans la banque de données UniProt/SwissProt au NCBI, identifiez les séquences protéiques "THAP" de l'homme, la souris, le poulet et le zebrafish. Eliminez les séquences isoformes 2 et 3.
  • Récupérez l'ensemble des séquences dans un fichier au format Fasta
  • Réalisez un alignement de l'ensemble des séquences (=alignement multiple) en utilisant Clustal Omega disponible a l'EBI (>Services)
  • Trouvez-vous des 'zones similaires' (=domaines) à l'ensemble de ces séquences.

NB : Le motif 'AVPTIF' marque une partie du domaine : le trouvez-vous sur toutes les séquences ?

Nous allons maintenant essayer de construire un pattern/signature caractéristique de cette famille de protéine en sebasant sur les 'zones similaires' préalablement identifiées

  • Construire une signature PROSITE à partir de votre alignement (n'utilisez pas le LOGO, sinon vous ne voyez pas précisément les zones de gap)
   Voici l'exemple d'un début d'une signature (ou pattern) : Q-L-x(3)-P-x(6)-[FY]-x(2)-V-x(3)-[LVF]-[FGD]-x(2,8)-[GPS]

Comment lire cette signature ?

    Q-L : il n'y a que les acides aminés Q puis L dans 2 colonnes successives de l'alignement 
x(3) : 3 colonnes avec des acides aminés variables
[FY] : dans cette colonne seuls les acides aminés F ou Y sont présents
x(2,8) : zone avec un gap. Entre 2 et 8 résidus (acides aminés) quelconques, suivant les séquences
  • Tester la spécificité de votre signature sur ScanProsite (choisir l'option 2) contre SwissProt ou trEMBL (plus long !)

Mise en application...

Au laboratoire, vous êtes amenés a travailler sur la séquence ci-dessous:


attggcaacctgaaagatctgaacattctgtatctgcatagcaacggctttaccggccgc attccgcgcgaaatgagcaacctgaccctggcgaacctgaccgatctggatctgagcggc aaccagctgaccggcaaaattccgcgcgattttgcggcgctgctgctggtgctgctggaa aaaaaaattgaaaacattacctgcgatagcatgaaactgctgagcaaaacctttctgatt ctgaccctgaccttttttttttttggcattgcgctggcgaaacagagctttgaaccggaa attgaagcgctgaaaagctttaaaaacggcattagcaacgatccgctgggcgtgctgagc gattggaccattattggcagcctgcgccattgcaactggaccggcattacctgcgatagc accggccatgtggtgagcgtgagcctgctggaaaaacagctggaaggcgtgctgagcccg gcgattgcgaacctgacctatctgcaggtgctggatctgaccagcaacagctttaccggc aaaattccggcggaaattggcaaactgaccgaactgaaccagctgattctgtatctgaac tattttagcggcagcattccgagcggcatttgggaactgaaaaacattttttatctggat ctgcgcaacaacctgctgagcggcgatgtgccggaagaaatttgcaaaaccagcagcctg gtgctgattggctttgattataacaacctgaccggcaaaattccggaatgcctgggcgat ctggtgcatctgcagatgtttgtggcggcgggcaaccatctgaccggcagcattccggtg agcattggcaccctggcgaacctgaccgatctggatctgagcggcaaccagctgaccggc aaaattccgcgcgattttggcaacctgctgaacctgcagagcctggtgctgaccgaaaac ctgctggaaggcgatattccggcggaaattggcaactgcagcagcctggtgcagctggaa ctgtatgataaccagctgaccggcaaaattccggcggaactgggcaacctggtgcagctg caggcgctgcgcatttataaaaacaaactgaccagcagcattccgagcagcctgtttcgc ctgacccagctgacccatctgggcctgagcgaaaaccatctggtgggcccgattagcgaa gaaattggctttctggaaagcctggaagtgctgaccctgcatagcaacaactttaccggc gaatttccgcagagcattaccaacctgcgcaacctgaccgtgctgaccgtgggctttaac aacattagcggcgaactgccggcggatctgggcctgctgaccaacctgcgcaacctgagc gcgcatgataacctgctgaccggcccgattccgagcagcattagcaactgcaccggcctg aaactgctggatctgagccataaccagatgaccggcgaaattccgcgcggctttggccgc atgaacctgacctttattagcattggccgcaaccattttaccggcgaaattccggatgat atttttaactgcagcaacctggaaaccctgagcgtggcggataacaacctgaccggcacc ctgaaaccgctgattggcaaactgcagaaactgcgcattctgcaggtgagctataacagc ctgaccggcccgattccgcgcgaaattggcaacctgaaagatctgaacattctgtatctg catagcaacggctttaccggccgcattccgcgcgaaatgagcaacctgaccctgctgcag ggcctgcgcatgtatagcaacgatctggaaggcccgattccggaagaaatgtttgatatg aaactgctgagcgtgctggatctgagcaacaacaaatttagcggccagattccggcgctg tttagcaaactggaaagcctgacctatctgagcctgcagggcaacaaatttaacggcagc attccggcgagcctgaaaagcctgagcctgctgaacacctttgatattagcgataacctg ctgaccggcaccattccgggcgaactgctggcgagcctgaaaaacatgcagctgtatctg aactttagcaacaacctgctgaccggcaccattccgaaagaactgggcaaactggaaatg gtgcaggaaattgatctgagcaacaacctgtttagcggcagcattccgcgcagcctgcag gcgtgcaaaaacgtgtttaccctggattttagccagaacaacctgagcggccatattccg gatgaagtgtttcagggcatggatatgattattagcctgaacctgagccgcaacagcttt agcggcgaaattccgcagagctttggcaacatgacccatctggtgagcctggatctgagc agcaacaacctgaccggcgaaattccggaaagcctggcgaacctgagcaccctgaaacat ctgaaactggcgagcaacaacctgaaaggccatgtgccggaaagcggcgtgtttaaaaac attaacgcgagcgatctgatgggcaacaccgatctgtgcggcagcaaaaaaccgctgaaa ccgtgcaccattaaacagaaaagcagccattttagcaaacgcacccgcgtgattctgatt attctgggcagcgcggcggcgctgctgctggtgctgctgctggtgctgattctgacctgc tgcaaaaaaaaagaaaaaaaaattgaaaacagcagcgaaagcagcctgccggatctggat agcgcgctgaaactgaaacgctttgaaccgaaagaactggaacaggcgaccgatagcttt aacagcgcgaacattattggcagcagcagcctgagcaccgtgtataaaggccagctggaa gatggcaccgtgattgcggtgaaagtgctgaacctgaaagaatttagcgcggaaagcgat aaatggttttataccgaagcgaaaaccctgagccagctgaaacatcgcaacctggtgaaa attctgggctttgcgtgggaaagcggcaaaaccaaagcgctggtgctgccgtttatggaa aacggcaacctggaagataccattcatggcagcgcggcgccgattggcagcctgctggaa aaaattgatctgtgcgtgcatattgcgagcggcattgattatctgcatagcggctatggc tttccgattgtgcattgcgatctgaaaccggcgaacattctgctggatagcgatcgcgtg gcgcatgtgagcgattttggcaccgcgcgcattctgggctttcgcgaagatggcagcacc accgcgagcaccagcgcgtttgaaggcaccattggctatctggcgccggaatttgcgtat atgcgcaaagtgaccaccaaagcggatgtgtttagctttggcattattatgatggaactg atgaccaaacagcgcccgaccagcctgaacgatgaagatagccaggatatgaccctgcgc cagctggtggaaaaaagcattggcaacggccgcaaaggcatggtgcgcgtgctggatatg gaactgggcgatagcattgtgagcctgaaacaggaagaagcgattgaagattttctgaaa ctgtgcctgttttgcaccagcagccgcccggaagatcgcccggatatgaacgaaattctg acccatctgatgaaactgcgcggcaaagcgaacagctttcgcgaagatcgcaacgaagat cgcgaagtg

Répondez aux questions suivantes:

  • a quel organisme appartient cette séquence ?
  • cette séquence est-elle codante ?
  • quelle est le numéro d'accession de cette protéine, de l'ARNm, du gène ?
  • existe-il des orthologues a cette protéine ?
  • que veut dire db_xref=CDD:173623 sur la fiche GenPept?
  • quelle est la fonction putative de cette protéine ?
  • exite-t-il des domaines conservés dans cette protéine?