silico.biotoul.fr
 

Enseignements

From silico.biotoul.fr

(Difference between revisions)
Jump to: navigation, search
m (Emploi du temps 2019-20)
 
(884 intermediate revisions not shown)
Line 1: Line 1:
 +
<!-- = Contrôles terminaux en distanciel 2020 =
 +
 +
'''Bioinformatique pour la génomique M1 Bioinfo CT session 2 2 juillet 10h-12h30''' : [[Media:CT_session2_BG_M1Bioinfo_juillet_2020.docx|sujet CT Biooinformatique pour la Génomique]] -->
 +
= Licence 2 et 3 Biologie  =
= Licence 2 et 3 Biologie  =
-
=== Bioinformatique - 2B2M (EDSVB4IM), BCP (EDSVA4HM), BOPE (L2 EDSVC4MM, L3 ELSVC6JM) ===
+
=== Bioinformatique - Option L2-L3 2B2M-BCP-BOPE ===
 +
 
 +
UE en option avec différents codes :
 +
* L2 2B2M : EDSVB4IM
 +
* L2 BCP : EDSVA4HM
 +
* L2 BOPE : EDSVC4MM
 +
* L3 BOPE : ELSVC6JM
 +
 
 +
* Moodle : [https://moodle.univ-tlse3.fr/course/view.php?id=2518 EDSVB4IM]
 +
 
 +
===='''Emploi du temps 2019-20'''====
 +
 
 +
Aussi disponible sur https://calendar.google.com/calendar/embed?src=lic.bioinfo%40gmail.com&ctz=Europe/Paris
 +
 
 +
<html>
 +
<iframe src="https://calendar.google.com/calendar/embed?showTitle=0&amp;showCalendars=0&amp;mode=AGENDA&amp;height=400&amp;wkst=2&amp;hl=fr&amp;bgcolor=%23FFFFFF&amp;src=lic.bioinfo%40gmail.com&amp;color=%232952A3&amp;ctz=Europe%2FParis" style="border-width:0" width="550" height="400" frameborder="0" scrolling="no"></iframe>
 +
</html>
 +
 
 +
 
 +
 
 +
<big><big>'''Les groupes de TD et TP 2019-20 sont disponibles sur moodle : [https://moodle.univ-tlse3.fr/course/view.php?id=2518 https://moodle.univ-tlse3.fr/course/view.php?id=2518]'''</big></big>
 +
 
 +
 
 +
{| class="wikitable"
 +
!colspan="4"|EDT L2-L3 2B2M-BCP-BOPE Bioinformatique
 +
|-
 +
|                      || CM                                                  || TD        ||  TP
 +
|-
 +
| semaine 03 - 17/01  || 13h30-15h40 R. Barriot - Bioinfo générale (lien zoom sur moodle)<br/> 15h50-18h00 F. Delavoie - Imagerie         
 +
||
 +
||
 +
|-
 +
| semaine 04 - 24/01 
 +
||                   
 +
||         
 +
|| 13h30-15h50 groupes TP en U6-104, 105 et 106
 +
|-
 +
| semaine 05 - 31/01  || 13h30-15h40 R. Barriot - Bases de Données           
 +
|| 15h50-18h00 groupe TD1 en U6-205<br/>18h10-20h20 groupe TD2 en U6-205
 +
||
 +
|-
 +
| semaine 06 - 07/02  ||                                                   
 +
||         
 +
|| 13h30-15h40 groupe TP en U6-104<br/>
 +
15h50-18h00 groupe TP en U3-204<br/>
 +
18h10-20h20 groupe TP en U6-104
 +
|-
 +
| semaine 07 - 14/02  || 13h30-15h40 M. Bonhomme                                                   
 +
||         
 +
|-
 +
| semaine 08 - 21/02  ||                                                   
 +
||         
 +
|| 13h30-15h50 groupes TP en U6-104, 105 et 106
 +
|-
 +
| semaine 09 - 28/02  ||
 +
||         
 +
||
 +
|-
 +
| semaine 10 - 07/03  || '''13h30-15h30 Contrôle avec report
 +
||         
 +
|| 
 +
|- 
 +
| semaine 11 - 14/03  || 13h30-15h40 Gwennaele Fichant - Modélisation et Biologie des systèmes                 
 +
|| 
 +
||
 +
|-
 +
| semaine 12 - 21/03  ||                                           
 +
||
 +
|| 13h30-15h40 groupe TP en 4TP4-P15<br/>
 +
15h50-18h00 groupe TP en 4TP4-P15<br/>
 +
18h10-20h20 groupe TP en 4TP4-P15
 +
|-
 +
| semaine 13 - 28/03  ||
 +
||  13h30-15h40 groupe TD1 en U6-215<br/>
 +
15h50-18h00 groupe TD2 en U6-215     
 +
||
 +
|-
 +
| semaine 14 - 04/04  ||
 +
||         
 +
|| 13h30-15h40 groupe TP en 4TP2-M6<br/>
 +
15h50-18h00 groupe TP en 4TP2-M6<br/>
 +
18h10-20h20 groupe TP en 4TP2-M6
 +
|-
 +
| semaine 15 - 11/04  ||    '''13h45-15h15 Contrôle terminal anticipé'''                                                   
 +
||         
 +
|| 
 +
|}
 +
 
 +
 
 +
 
-
=== BioAnalyse L3 - 2B2M et BCP ===
 
-
* TD1 : [[TD1_Bionalyse|Interrogation des banques de données]]
 
-
* TD2 : [[TD2_Bionalyse|Alignement par paires]]
 
-
* TD3 : [[Bioanalyse_TD_Analyse_de_sequences_et_Biologie_Moleculaire|Analyse de séquences et biologie Moléculaire]]
 
-
* TD4 : [[TD4_Bionalyse|BLAST, alignement multiple, signature protéique]]
 
<!--
<!--
 +
|-
 +
| semaine 20 - 15.05  ||                                            ||          || '''<span style='color: #F00'>12h-13h Consultation des copies en 4TP4-P15</span>'''
 +
 +
'''Groupes de TD'''
 +
 +
{| style="border-collapse: separate; border-spacing: 0; border-width: 1px; border-style: solid; border-color: #aabbcc; padding: 3px; width: 100%; background-color: #bbccdd; text-align: center;"
 +
!colspan="3"|Groupes de TD
 +
|- style="background-color: #ddeeff;"
 +
| style="padding-left: 0.5em; border-width: 1px; border-style: solid;" | Groupe 1
 +
| style="padding-left: 0.5em; border-width: 1px; border-style: solid;" | Groupe 2
 +
|- style="background-color: #ddeeff;"
 +
| style="padding-left: 0.5em; border-width: 1px; border-style: solid;" |
 +
 +
L2 BCP<br/>
 +
et<br/>
 +
L2 2B2M (Nom de famille commençant par : A jusqu'à G inclus)
 +
 +
| style="padding-left: 0.5em; border-width: 1px; border-style: solid;" |
 +
 +
L2/L3 BOPE<br/>
 +
et
 +
<br/>
 +
L2 2B2M (Nom de famille commençant par : K à Z)
 +
 +
|}
 +
-->
 +
 +
===='''Supports de cours'''====
 +
* CM1 [[Media:LBioinfo.intro.pdf|Introduction à la bioinformatique]]
 +
* CM2 [[Media:LBioinfo.traitement.d.images.pdf|Traitement d'images]]
 +
* CM3 [[Media:LBioinfo.systemes.d.information.pdf|Introduction aux bases de données]]
 +
* CM4 [[Media:L2_UE_Bioinfo_Genetics_2021.pdf|Utilisation de l'information génétique en biologie]]
 +
* CM5 [[Media:LBioinfo.bioseq.pdf|Introduction à la bioinformatique des séquences]]
 +
<!--
 +
* CM5 [[Media:Intro_BioSyst_L2_2019.pdf|Introduction à la biologie des système : initiation à la modélisation de réseaux de gènes]] -->
 +
 +
===='''Sujets de TD/TP'''====
 +
* [[L2-L3 Bioinfo - TP Traitement d'images 1h20|TP1]] Traitement d'images
 +
* [[L2-L3 Bioinfo - TD Bases de donnees|TD1]] Bases de données
 +
* [[L2-L3 Bioinfo - TP Bases de donnees|TP2]] Bases de données
 +
* [[L2-L3 Bioinfo - TP Analyses statistiques des données (phénotypes,génotypes)|TP3]] Analyses statistiques des données (phénotypes, génotypes)
 +
* [[L2-L3 Bioinfo - TP Banques de données et analyse de séquences|TP4]] Banques de données et analyse de séquences
 +
* [[Media:L2-L3 Bioinfo - TD Transcriptomique.pdf|TD2]] Transcriptomique
 +
* [[Media:TP_modelisation_regulation_fls2.pdf|TP5 Modélisation d'un réseau de régulation]]
 +
** [[Media:snoopy.7z|archive installation de snoopy]]
 +
** [[Media:fls2_regulation_simplifie.spn|réseau de Petri stochastique pour la régulation de fls2]]
 +
** [[Media:TP_regulation_fls2.pdf|correction du TP5 Modélisation d'un réseau de régulation]]
 +
 +
= BioAnalyse L3 BCP (ELSV6CM1) =
 +
 +
==='''2021_2022 Planning des Enseignements ... A venir'''===
 +
Toutes les informations relatives à l'UE de Bioanalyse seront également disponibles dans l'espace dédié sur Moodle
 +
 +
<!--
 +
* [[Media:2021-Planning_Bionalyse_L3 BCP_AVEC_salles_TP3.pdf|2021 Planning Bioanalyse L3 BCP (semaine rouge/bleue), mise a jour du Lundi 18 Janvier 21]]
 +
* [[Media:2021_GroupesTPs.pdf|2021 Séries de TP Bioanalyse (rouge/bleue) L3 BCP]]
 +
* [[Media:2021_Liens Zoom CMs Bioanalyse.pdf|2021 Liens Zoom pour CMs en distanciel de l'UE]]
 +
* [[Media:2021_Presentation de l'UE_OK_TP3.pdf|2021 Présentation de l'UE, mise à jour du Lundi 28 Janvier 21]]
 +
 +
 +
* [[Media:1920_Bioanalyse_planning.pdf|Planning Bioanalyse L3 BCP 2019_2020]]
 +
* [[Media:presentation_UE_bioanalyse_2020.pdf|Présentation de l'UE]]
 +
* [[Media:1819_Planning TPS CMs.pdf|Planning Bioanalyse L3 BCP 2018_2019]]
 +
* [[Media:presentation_UE_bioanalyse_2019.pdf|Présentation de l'UE]]
 +
 +
<!--===='''Vidéos des Cours'''====
 +
* CM1 : [http://silico.biotoul.fr/enseignement/L3-Biologie/Videos_Cours_L3BCP_Bionalyse_2021/Introduction_Bioinfo.mp4 Introduction à la bioinformatique]
 +
* CM1 : [[Media:Introduction_bioinfo_2020_modified.pdf|Introduction à la bioinformatique]]
 +
* CM2 : [[Media:banque_2020.pdf|Introduction aux banques de données]]
 +
* CM3 : [[Media:Alignement_seq_nuc.pdf|Alignement de deux séquences d'acides nucléiques]]
 +
* CM4 : [[Media:Alignement_seq_prot_2015.pdf|Alignement de deux séquences protéiques : les matrices de substitution]]
 +
* CM5 : [[Media:Blast_2020.pdf|Recherche par similarité dans les bases de données]]
 +
* CM6 : [[Media:AlignementMultiple_2017.pdf|Alignement multiple]]
 +
* CM6 : [[Media:motif_profil_2017.pdf|Motif et domaine fonctionnels]]
 +
 +
 +
-- ===='''Videos des Cours'''====
 +
* CM1 : [http://silico.biotoul.fr/enseignement/L3-Biologie/Videos_Cours_L3BCP_Bionalyse_2021/Introduction_Bioinfo.mp4 Introduction à la bioinformatique]
 +
* CM2 : [http://silico.biotoul.fr/enseignement/L3-Biologie/Videos_Cours_L3BCP_Bionalyse_2021/bases_donnees.mp4 Introduction aux banques de données]
 +
* CM2 : [http://silico.biotoul.fr/enseignement/L3-Biologie/Videos_Cours_L3BCP_Bionalyse_2021/erratum_bases_donnees.mp4 petit erratum Introduction aux banques de données]
 +
* CM3 : [http://silico.biotoul.fr/enseignement/L3-Biologie/Videos_Cours_L3BCP_Bionalyse_2021/Comparaison_deux_sequences_partie1.mp4 Comparaison de deux séquences-partie_1]
 +
* CM4 : [http://silico.biotoul.fr/enseignement/L3-Biologie/Videos_Cours_L3BCP_Bionalyse_2021/comparaison_deux_sequences_partie2.mp4 Comparaison de deux séquences-partie_2]
 +
* CM5 : [http://silico.biotoul.fr/enseignement/L3-Biologie/Videos_Cours_L3BCP_Bionalyse_2021/recherche_similarite_avec_Blast.mp4 Recherche par similarité dans les bases de données]
 +
* CM5 : [http://silico.biotoul.fr/enseignement/L3-Biologie/Videos_Cours_L3BCP_Bionalyse_2021/Alignement_multiple.mp4 Alignement multiple]
 +
* CM6 : [http://silico.biotoul.fr/enseignement/L3-Biologie/Videos_Cours_L3BCP_Bionalyse_2021/Motifs_domaines_fonctionnels.mp4 Motifs et domaines fonctionnels]
 +
-->
 +
 +
===='''Supports de Cours'''====
 +
* CM1 : [[Media:Introduction_bioinfo_2020_modified.pdf|Introduction à la bioinformatique]]
 +
* CM2 : [[Media:banque_2020.pdf|Introduction aux banques de données]]
 +
* CM3 : [[Media:Alignement_seq_nuc.pdf|Alignement de deux séquences d'acides nucléiques]]
 +
* CM4 : [[Media:Alignement_seq_prot_2021.pdf|Alignement de deux séquences protéiques]]
 +
* CM5 : [[Media:Blast_2021.pdf|Recherche par similarité dans les bases de données]]
 +
* CM5 : [[Media:AlignementMultiple_2021.pdf|Alignement multiple]]
 +
* CM6 : [[Media:motif_profil_2021.pdf|Motifs et domaines fonctionnels]]
 +
 +
<!--
 +
===='''TPs, année 2020_2021'''====
 +
 +
 +
* TP1 : [[TP1_Bioanalyse|Interrogation des banques de données et Analyses de Séquences]]
 +
* TP2 : [[TD2_Bioanalyse|Alignement par paires]]
 +
* TP3 : [[TD3_Bioanalyse21|Blast, Alignement multiple et Signatures]]
 +
 +
-->
 +
 +
===='''TPs en salle'''====
 +
 +
* TP1 : [[TD1_Bioanalyse|Interrogation des banques de données]]
 +
* TP2 : [[TD2_Bioanalyse|Alignement par paires]]
 +
* TP3 : [[Bioanalyse_TD_Analyse_de_sequences_et_Biologie_Moleculaire|Analyse de séquences et biologie Moléculaire]]
 +
* TP4 : [[TD4_Bioanalyse|BLAST, alignement multiple, signature protéique]]
 +
* TP5 : [[TD5_Bioanalyse|Revisions]]
 +
 +
===='''Annales & Corrigés'''====
 +
 +
* CT 2019 : [[Media:2019_CT_L3Bioanalyse_Corrigé_ETU.pdf|Questions + corrections]]
 +
* CC 2019 : [[Media:2019_CC_L3Bioanalyse_Corrigé_ETU.pdf|Questions + corrections]]
 +
* CC 2017 : [[Media:sujet_CC_Bioanalyse_L3BCP_2017_correction.pdf|Questions + corrections]]
 +
* CC 2014 : [[Media:Correction_sujet_CC_L3Biologie_EL6BIOFM_2014.pdf|Questions + corrections]]
 +
* CC 2014 : [[Media:correction_alignement_CC_2013.pdf|correction de la construction de la matrice de programmation dynamique]]
 +
* CC 2013 : [[Media:Correction_sujet_CC_L3Biologie_EL6BIOFM.pdf|Questions + corrections]]
 +
 +
= BioAnalyse L3 2B2M =
 +
 +
===='''TPs'''====
 +
 +
* TP1 : [[TD1_Bioanalyse|Interrogation des banques de données]]
 +
* TP2 : [[TD2_Bioanalyse|Alignement par paires]]
 +
* TP3 : [[Bioanalyse_TD_Analyse_de_sequences_et_Biologie_Moleculaire|Analyse de séquences et biologie Moléculaire]]
 +
* TP4 : [[TD4_Bioanalyse|BLAST, alignement multiple, signature protéique]]
 +
* TP5 : [[TD5_Bioanalyse|Revisions]]
 +
 +
= Licence Pro GeBAP =
 +
=== Schéma de sélection et productions de semences ===
 +
* [[L3 GeBAP - TP Analyse de QTL|TP]] Analyse de QTL
 +
 +
= Licence 3 Biologie des Organismes des populations et Ecosystemes (BOPE)  =
 +
=== Du génome à la sélection des plantes (ELSVC5EM) ===
 +
 +
<!--
 +
TP pour une seance unique de 4h
 +
-->
 +
 +
* TP : [[TP Initiation Bioanalyse |Initiation Bioanalyse]]
 +
 +
<!--
 +
Initiation à la 'Bioanalyse'
 +
* TP1 : [[TD1_Genome Selection Plantes|Interrogation des banques de données et recherche par similarité]]
 +
* TP2 : [[TD2_Genome Selection Plantes|Alignement multiples et signatures protéiques]]
 +
 +
==== Harmonisation des Connaissances, partie Bioanalyse (EMBIA1IM) ====
 +
* Supports de cours
 +
http://www.mabs.ups-tlse.fr/index.php/Ressources_pedagogique#Bioanalyse_.28EM7BMGD2.29
 +
* TD1 : [[Interrogation des banques de données]]
 +
* TD2 : [[Analyse de séquences I: recherche par similarité, alignements deux à deux]]
 +
* TD3 : [[Analyse de séquences II: alignements multiples et profils]]|
 +
 +
== Licence 3 ==
== Licence 3 ==
 +
 +
* TD1 : [[Interrogation des banques de données]]
 +
* TD2 : [[Analyse de séquences I: recherche par similarité, alignements deux à deux]]
 +
* TD3 : [[Analyse de séquences II: alignements multiples et profils]]|
 +
-->
 +
<!--
=== Biologie - 2B2M (ELSVB5FM) et BCP (ELSVA6CM) : Bioanalyse ===
=== Biologie - 2B2M (ELSVB5FM) et BCP (ELSVA6CM) : Bioanalyse ===
'''Supports de cours :'''
'''Supports de cours :'''
Line 36: Line 289:
<!--
<!--
'''Annales :'''
'''Annales :'''
-
 
* [[silico:enseignement/L3-Biologie/sujet_CC_2012_pdf.pdf|exemple de sujet de contrôle continu 2012]]
* [[silico:enseignement/L3-Biologie/sujet_CC_2012_pdf.pdf|exemple de sujet de contrôle continu 2012]]
* [[silico:enseignement/L3-Biologie/correction_sujet_CC_2012.pdf|correction du sujet de contrôle continu du 6 mars 2012]]
* [[silico:enseignement/L3-Biologie/correction_sujet_CC_2012.pdf|correction du sujet de contrôle continu du 6 mars 2012]]
Line 42: Line 294:
* [[silico:enseignement/L3-Biologie/Correction_exam_janvier_2009.pdf|correction du sujet de contrôle terminal de janvier 2009]]
* [[silico:enseignement/L3-Biologie/Correction_exam_janvier_2009.pdf|correction du sujet de contrôle terminal de janvier 2009]]
* [[silico:enseignement/L3-Biologie/Annales_probleme.pdf|un autre exemple de problème de contrôle terminal]]
* [[silico:enseignement/L3-Biologie/Annales_probleme.pdf|un autre exemple de problème de contrôle terminal]]
-
 
'''Supports de TD :'''
'''Supports de TD :'''
Line 52: Line 303:
-->
-->
<!--
<!--
-
 
* * TD4 : [[Bioanalyse_TD_Analyse_d_une_famille_de_proteines|Analyse d'une famille de protéines]]
* * TD4 : [[Bioanalyse_TD_Analyse_d_une_famille_de_proteines|Analyse d'une famille de protéines]]
* TD5 : [[Bioanalyse_TD_Analyse_evolutive|Analyse évolutive]]
* TD5 : [[Bioanalyse_TD_Analyse_evolutive|Analyse évolutive]]
Line 64: Line 314:
==== Traitement de données biologiques (EMBIA1FM) ====
==== Traitement de données biologiques (EMBIA1FM) ====
-
'''Support de cours:'''
 
-
* [[Media:M1 Traitement de Donnees Biologiques - Statistiques et Analyses Multivariees.pdf|Statistiques et Analyses Multivariées - M. Bonhomme]]
 
-
* [[Media:Transcriptome.pdf|Transcriptome - R. Barriot]] (version 2011-2015, sera mis à jour pour le 10/10/2016)
 
-
'''Support de TD/TP:'''
+
'''Supports de cours :'''
-
* [[M1 Traitement de Donnees Biologiques - TP 1 Intro R|Introduction à R]]
+
* [[Media:M1 Traitement de Donnees Biologiques - Statistiques et Analyses Multivariees.pdf|Statistiques - M. Bonhomme]]
-
* [[M1 Traitement de Donnees Biologiques - TP 2 Régression linéaire, probabilités, intervalles de confiance|Régression linéaire, probabilités, intervalles de confiance]]
+
* [[Media:Transcriptome.pdf|Transcriptome - R. Barriot]]
-
* Les suivants sont en cours de mise à jour
+
 
 +
'''Supports de TD/TP :'''
 +
* [[M1 Traitement de Donnees Biologiques - TP Intro R|TP1 - Introduction à R]]
 +
* [[M1 Traitement de Donnees Biologiques - TP 2 R|TP2 - Régression linéaire, probabilités, intervalles de confiance]]
 +
* [[M1 Traitement de Donnees Biologiques - TP 3 R|TP3 - Tests statistiques - 1]]
 +
* [[M1 Traitement de Donnees Biologiques - TP 4 R|TP4 - Tests statistiques - 2 (ANOVA)]]
 +
* [[M1 Traitement de Donnees Biologiques - Transcriptome - Oryza sativa|TP5 - Analyse de transcriptome]]
 +
 
* [[procedure_install_Rstudio|procédure d'installation de R/Rstudio sur votre ordinateur]]
* [[procedure_install_Rstudio|procédure d'installation de R/Rstudio sur votre ordinateur]]
<!--
<!--
 +
* Les suivants sont en cours de mise à jour
* [[Media:M1 MABS Traitement de Donnees Biologiques - TP tests.zip|Tests]]
* [[Media:M1 MABS Traitement de Donnees Biologiques - TP tests.zip|Tests]]
* [[Media:M1 MABS Traitement de Donnees Biologiques - TP tests ANOVA.zip|Tests et ANOVA]]
* [[Media:M1 MABS Traitement de Donnees Biologiques - TP tests ANOVA.zip|Tests et ANOVA]]
Line 81: Line 336:
-->
-->
-
'''Liens'''
+
<!--
 +
 
 +
 
 +
 
 +
<big>'''Contrôle continu'''</big>
 +
* Contrôle continu 2019-20 : [[silico:enseignement/m1/tdb/CC2019/|Sujet et fichiers à utiliser]]
 +
 
 +
 
 +
<big>'''Contrôle continu'''</big>
 +
* Contrôle continu 2018-19 : [[silico:enseignement/m1/tdb/CC2018/|Sujet et fichiers à utiliser]]
 +
 
 +
<big>'''Contrôle continu'''</big>
 +
* Contrôle continu 2017-18 : [[silico:enseignement/m1/tdb/CC2017/|Sujet et fichiers à utiliser]]
 +
-->
 +
 
 +
<!--
 +
'''Contrôle continu'''
 +
* Contrôle continu 2016 : [[silico:enseignement/m1/tdb/cc2016.html|Sujet et fichiers à utiliser]]
 +
-->
 +
 
* Archives
* Archives
** Contrôle continu de 2011 avec son corrigé [[Media:M1 MABS Traitement de Donnees Biologiques - CC 2011 et correction.zip|CC 2011 et correction.zip]]
** Contrôle continu de 2011 avec son corrigé [[Media:M1 MABS Traitement de Donnees Biologiques - CC 2011 et correction.zip|CC 2011 et correction.zip]]
 +
 +
'''Liens'''
* Documentation
* Documentation
** [[Media:R_refcard.pdf|Aide mémoire des commandes R]]
** [[Media:R_refcard.pdf|Aide mémoire des commandes R]]
Line 93: Line 369:
** RStudio : https://www.rstudio.com
** RStudio : https://www.rstudio.com
** https://www.datacamp.com Apprendre R en ligne
** https://www.datacamp.com Apprendre R en ligne
 +
** https://rdrr.io/snippets/ Utilisation de R depuis un navigateur
 +
<!-- deprecated
** http://tryr.codeschool.com/levels/1/challenges/1 Apprendre en ligne aussi
** http://tryr.codeschool.com/levels/1/challenges/1 Apprendre en ligne aussi
** http://www.r-fiddle.org Utilisation de R depuis un navigateur
** http://www.r-fiddle.org Utilisation de R depuis un navigateur
 +
-->
==== Génétique Evolutive et Quantitative (EMBIA1GM) ====
==== Génétique Evolutive et Quantitative (EMBIA1GM) ====
'''Support de cours:'''
'''Support de cours:'''
-
* [[Media: GEQ_presentation.pdf|présentation de GEQ - M. Bonhomme]]
+
* [[Media: GEQ_presentation1.pdf|présentation de GEQ - M. Bonhomme]]
* [[Media: GEQ_intro.pdf|introduction à GEQ - M. Bonhomme]]
* [[Media: GEQ_intro.pdf|introduction à GEQ - M. Bonhomme]]
-
* [[Media: GEQ_pop_gen.pdf|Génétique des populations (GE) - M. Bonhomme]]
+
* [[Media: GEQ_pgen.pdf|GE - Génétique des populations - M. Bonhomme]]
 +
* [[Media: CM_Genetique_Quantitative_2020bis.pdf|GQ - Génétique-Quantitative - M. Bonhomme]]
 +
* [[Media: Carto_Génétique_2019.pdf|GQ - Cartographie génétique - M. Bonhomme]]
 +
'''Supports de TD/TP :'''
 +
* [[Media: TD1_GEQ_pgen.pdf|TD1 génétique des populations]]
 +
* [[Media: TP1_population_genetics_2020.zip|TP1 génétique des populations]]
 +
* [[Media: TD-Génétique_Quantitative_2019.pdf|TD2 génétique quantitative]]
 +
* [[Media: TP2_heritability_2020.zip|TP2 génétique quantitative]]
 +
* [[Media: TD3_carto_génétique_2019.pdf|TD3 cartographie génétique]]
 +
 +
==== Génomique Evolutive et Phylogénie ====
 +
 +
'''Supports de TD/TP :'''
 +
* [[M1 Genomique Evolutive et Phylogenie - TP 2 Evolution proteine d'oomycete|TP: Evolution proteine d'oomycete]]
 +
<!--
 +
*[[Media:TP2_Evolution_proteine_oomycete.pdf|TP Evolution proteine d'oomycete]]
 +
**''Données pour le TP'':
 +
[[Media:fungal_sequences.txt|Fungal_sequences]]
 +
[[Media:ATPsynthase_ sequences.txt|ATPsynthase_sequences]]
 +
[[Media:Richard_HGT_oomycetes_PNAS_2011.pdf|Publication de reference]]
 +
[[Media:Richard_HGT_oomycetes_PNAS_2011_SI.pdf|Publication de reference, supplementary data]]
 +
-->
 +
 +
*[[Media:TP4_adaptation_moleculaire.pdf|TP Adaptation Moleculaire]]
 +
**''Données pour le TP'':
 +
[[Media:Medicago_SNPs_sequences.txt|Medicago SNPs sequences]]
 +
[[Media:Drosophila_Adh.phy|Drosophile sequences]]
 +
[[Media:Primates_lysozymes.fasta|Primates lysozymes sequences]]
=== Master 1 - Bioinformatique et Biologie des Systèmes + Biotechnologies ===
=== Master 1 - Bioinformatique et Biologie des Systèmes + Biotechnologies ===
==== Evolution Moléculaire (EMBIA2EM) ====
==== Evolution Moléculaire (EMBIA2EM) ====
-
* [[silico:enseignement/m1-mabs/EvolMol/|Ressources pédagogiques]]
+
<!--'''Emploi du temps :'''
 +
* [[Media:EDT_2021_UE_Evolution_Moleculaire_M1BI_M1BT.pdf|Emploi du temps UE Evolution moléculaire]]-->
 +
'''Supports de cours :'''
 +
* [[Media:cours_EM_intro_2021_updated.pdf|Introduction à l'évolution moléculaire]]
 +
* [[Media:Phylogenie_Definitions_2021.pdf|Evolution moléculaire : définitions]]
 +
* [[Media:Phylogenie_Modeles_Evolutifs_2021.pdf|Modèles évolutifs]]
 +
* [[Media:Phylogenie_Methodes_2021.pdf|Méthodes de reconstructions phylogénétiques ]]
 +
* [[Media:Phylogenie_Methodes_part2_2021.pdf|Méthodes de reconstructions phylogénétiques (suite)]]
 +
* [[Media:cours_EM_adapt_mol_2021_updated.pdf|Adaptation moléculaire]]
 +
 
 +
<!-- '''Videos des Cours'''
 +
* CM1 : [http://silico.biotoul.fr/enseignement/m1-bioinfo/EvolMol/Introduction_phylogenie_moleculaire.mp4 Introduction phylogénie moléculaire - définitions- notions de base]
 +
* CM2 : [http://silico.biotoul.fr/enseignement/m1-bioinfo/EvolMol/Model_evolution_ac_nucl.mp4 Modèles d'évolution séquences d'acides nucléiques]
 +
* CM3 : [http://silico.biotoul.fr/enseignement/m1-bioinfo/EvolMol/Model_evolution_prot.mp4 Modèles d'évolution séquences protéiques]
 +
* CM4 : [http://silico.biotoul.fr/enseignement/m1-bioinfo/EvolMol/Methode_part1.mp4 Méthode de distance et méthode de maximum de parcimonie]
 +
* CM5 : [http://silico.biotoul.fr/enseignement/m1-bioinfo/EvolMol/Methods_part2_robustesse.mp4 Méthode de maximum de vraisemblance et robustesse des arbres] -->
 +
 
 +
'''Support TP : '''
 +
* [[silico:enseignement/m1-mabs/EvolMol/TD1/index.html|tutorial TP1 et TP2]]
 +
* [[Media:Introduction_competence_2020.pdf|Petit topo d'introduction sur la régulation de la compétence chez ''S. pneumoniae'']]
 +
<!-- **[[Media:Correction_TP1_TP2_2018.pdf|Correction des TP1 et TP2]]
 +
** [[silico:enseignement/m1-mabs/EvolMol/M1_EvolMol_Rstudio.tar.gz|Fichier Rstudio pour les TP1 et TP2]]
 +
** [[Media:SpneA01-NJ_tuto_muscle_Poisson.tree.ph | arbre COME NJ modèle Poisson]]
 +
** [[Media:SpneA01-NJ_tuto_muscle_Kimura.tree.ph | arbre COME NJ modèle Kimura]]
 +
** [[Media:SpneA01-PhyML_LG_tree.ph | arbre COME PhyML modèle LG]]
 +
** [[Media:SpneA01-PhyML_LG_empirical_tree.ph | arbre COME PhyML modèle LG fréquence des bases empiriques]]
 +
** [[Media:SpneA01.COMD_CleanUp_tuto_muscle.fst | alignement multiple COMD]]
 +
** [[Media:SpneA01-PhyML_ComD_LG_tree.ph | arbre COMD PhyML modèle LG]]
 +
** [[Media:SpneA01-PhyML_ComD_LG_empirical_tree.ph | arbre ComD PhyML modèle LG fréquence des bases empiriques]]-->
 +
 
 +
 
 +
* [[Media:questions_reponses_ComD_ComE_trees_srep_2019.pdf|Questionnaire sur l'analyse des arbres ComE et ComD]]
 +
<!-- ** [[Media:questions_reponses_ComD_ComE_trees_2021.pdf|Correction du questionnaire sur l'analyse des arbres ComE et ComD]]-->
 +
 
 +
 
 +
* [[Media:TP3_adaptation_moleculaire_2021.zip|tutorial TP3]]
 +
* [[Media:TP3_adaptation_moleculaire_2019_2020.zip|tutorial TP3_2019_2020]]
 +
 
 +
 
 +
'''Support TD : '''
 +
 
 +
* [[Media:TD1_Evolution_Moleculaire.pdf|TD1 ]]
 +
* [[Media:TD2_EMBAIE_M1_Bioinfo_M1_Biotech.pdf|TD2 exemple de Contrôle continu ]]
 +
<!-- ** [[Media:Correction_TD2_Evolution_Moleculaire_2021.pdf|Correction du TD2 ]]-->
 +
* [[Media:TD3_Evolution Moléculaire_2021.pdf|TD3 Adaptation moléculaire ]]
 +
 
 +
<!--'''Exemple CC corrigé : '''
 +
* [[Media:sujet_CC_complet.pdf|CC de 2011 ]]
 +
* [[Media:correction_CC_oct-2011.pdf|correction du CC de 2011 ]]-->
 +
 
 +
 
 +
<!--* [[silico:enseignement/m1-mabs/EvolMol/|Ressources pédagogiques]]
<!--* [[silico:enseignement/m1-mabs/EvolMol/TD1/|TD 1]]
<!--* [[silico:enseignement/m1-mabs/EvolMol/TD1/|TD 1]]
Line 117: Line 474:
=== Master 1 - Bioinformatique et Biologie des Systèmes ===
=== Master 1 - Bioinformatique et Biologie des Systèmes ===
 +
 +
* Diaporama réunion de rentrée [[Media:M1BBS.Accueil.Inscriptions.Pedagogiques.pdf]]
* [[Linux tips]]
* [[Linux tips]]
Line 122: Line 481:
==== Bioinformatique pour la Génomique (EMBIA1DM) ====
==== Bioinformatique pour la Génomique (EMBIA1DM) ====
-
* [[silico:enseignement/m1-mabs/BGPG/|Cours et TP]]
+
'''Supports de cours :'''
 +
 
 +
* [[Media:Cours_Introduction_Jean_Phillipe_Galaud.pdf|Introduction génomique  (Jean-Philippe Galaud)]]
 +
* [[Media:Introduction_bio_annotation_2021.pdf|Introduction biologique  (Gwennaele Fichant)]]
 +
* [[Media:Annotation1.pdf|Annotation partie 1 (Gwennaele Fichant)]]
 +
* [[Media:annotation2_2021_new.pdf|Annotation partie 2 (Gwennaele Fichant)]]
 +
* [[Media:motif_profil_2017.pdf|Définition et identification des motifs et profils dans les séquences (cours de L3 Bioanalyse) (Gwennaele Fichant)]]
 +
* [[Media:HMM_2021.pdf|Modèle de Markov Caché (HMM) (Gwennaele Fichant)]]
 +
* [[Media:cours-align_genome.pdf|Introduction aux alignements de génomes bactériens (Gwennaele Fichant)]]
 +
 
 +
'''Tutoriels de TP :'''
 +
*[[silico:enseignement/m1-bioinfo/BG/TD_annotation/Tutorial_annotation_v1_2019.html|Annotation d'un fragment génomique bactérien]]
 +
*[[Media:correction_TP_annotation.pdf | '''Correction du TP d'annotation du fragment génomique bactérien''']]
 +
<!--*[[silico:enseignement/m1-bioinfo/BG/summary_SignalP.pdf|Petite explication de SignalP]] -->
 +
*[[silico:enseignement/m1-bioinfo/BG/TD_HMM/TD_HMM_2017.html| design d'un HMM pour prédire les promoteurs sigma A de B. subtilis]]
 +
**[[Media:SHOW.tar.gz|archive compressée de SHOW à télécharger]]
 +
**[[silico:enseignement/m1-bioinfo/BG/TD_HMM/seq.tar.gz|archive des séquences compressée]]
 +
<!-- *to download: [[silico:enseignement/m1-bioinfo/BG/TD_HMM/show_saba.tar.gz| show_saba.tar.gz]] -->
 +
<!--*[[Media:Complement_TD_HMM.pdf|Complément d'information pour réaliser le TD de design du HMM ]]-->
 +
 
 +
Aide pour la réalisation du projet annotation
 +
*[[silico:enseignement/m1-bioinfo/BG/TD_artemis/Annotation_artemis.html|Introduction à Artemis]]
 +
*[[silico:enseignement/m1-bioinfo/BG/memo_Perl.html|Petit guide de programmation en Perl]]
 +
 
 +
'''Contrôle continu :'''
 +
 
 +
*'''Rapport de TP''' sur le design d'un HMM à rendre au plus tard le '''lundi 11 octobre 2021'''. M'envoyer par courrier le rapport en format pdf. Merci aussi de joindre au mail, '''uniquement si vous avez fait tourner tourner vous-même les programmes show_emfit et show_viterbi''', le fichier en format texte comportant votre modèle avant estimation des probabilités et celui après estimation des probabilités.
 +
 
 +
* '''Projet annotation''' d'un fragment génomique à remettre au plus tard '''le lundi 6 décembre 2021'''
 +
** '''Description du travail à réaliser dans le fichier ci-joint''' : [[Media:Projet_2019.docx|description du projet]]
 +
** '''Description du travail à réaliser pour les parsers dans le fichier ci-joint''' : [[Media:Description_parsers_2019.docx|description des parsers]]
 +
** '''Annoter une des deux séquences fournies''' : [[Media:seq1-5404.txt|séquence 1]] ou [[Media:seq2-7490.txt|séquence 2]]
 +
** [[Media:exemple_annotation_EMBL.txt|Exemple d'annotation au format EMBL]]
 +
 
 +
<!--* [[silico:enseignement/m1-mabs/BGPG/|Cours et TP]]
* [[M1MABS BGPG Projets|Projets à remettre pour le '''17 mai''']]
* [[M1MABS BGPG Projets|Projets à remettre pour le '''17 mai''']]
* [[Media:GRNs.pdf|Support de cours]] sur les réseaux de régulation. Quelques liens :
* [[Media:GRNs.pdf|Support de cours]] sur les réseaux de régulation. Quelques liens :
Line 132: Line 525:
* [[M1 MABS BBS BGPG TD GRNs|TD]] Reconstruction de réseaux de régulation
* [[M1 MABS BBS BGPG TD GRNs|TD]] Reconstruction de réseaux de régulation
* [[M1 MABS BBS BGPG TD GRNs - 2015|TD]] Reconstruction de réseaux de régulation (version 2015)
* [[M1 MABS BBS BGPG TD GRNs - 2015|TD]] Reconstruction de réseaux de régulation (version 2015)
 +
-->
<!--
<!--
* [[silico:enseignement/m1-mabs/BGPG/projet|Projets à remettre pour le '''17 mai''']]
* [[silico:enseignement/m1-mabs/BGPG/projet|Projets à remettre pour le '''17 mai''']]
-->
-->
 +
==== Mathématique pour la Biologie (EMBIA1EM) ====
==== Mathématique pour la Biologie (EMBIA1EM) ====
-
* [[Media:M1 MABS BBS Math Memento.pdf|Memento]] de Régine André-Obrecht
+
 
 +
'''Sujets de TP :'''
 +
 
* [[M1 MABS BBS Math TD Calcul Matriciel|TD]] Calcul matriciel
* [[M1 MABS BBS Math TD Calcul Matriciel|TD]] Calcul matriciel
 +
* [[M1 BBS Math TD ACP|TD]] ACP
* [[M1 MABS BBS Math TD Modelisation|TD]] Modélisation
* [[M1 MABS BBS Math TD Modelisation|TD]] Modélisation
-
* [[M1 MABS BBS Math TD ACP|TD]] ACP
 
* [[M1 MABS BBS Math TD Proba|TD]] Probabilités
* [[M1 MABS BBS Math TD Proba|TD]] Probabilités
 +
<!--
 +
<big>'''CCTP'''</big>
 +
* Exam CCTP 2021-22 : [[silico:enseignement/m1/math/cc/|Sujet et fichiers à utiliser]]
 +
-->
 +
 +
'''Liens :'''
 +
* http://exercism.io : améliorer son niveau de programmation dans différents langages (notamment R)
 +
 +
'''Références'''
 +
* ''Mathématiques pour les Sciences de la vie et de la Terre'' – C. David, S. Mustapha, F. Viens, N. Capron, edition Dunod
 +
 +
'''Projet 2021-22 :'''
 +
* [[silico:enseignement/m1/math/projet/M1BBS_Math_Sujet_Projet_2021-22.html|Sujet du projet 2021-22]]
 +
<!-- * Choix d'un graphe pour le projet (ne pas prendre un graphe déjà choisi par quelqu'un d'autre) : https://framadate.org/M1BBS-Projet-Math -->
 +
* Les projets sont à rendre '''avant''' les fêtes de fin d'année
 +
* Graphe à analyser
 +
*# [[silico:enseignement/m1/math/projet/g1.gr|graphe 1]] Sébastien
 +
*# [[silico:enseignement/m1/math/projet/g2.gr|graphe 2]]
 +
*# [[silico:enseignement/m1/math/projet/g3.gr|graphe 3]] Nassim
 +
*# [[silico:enseignement/m1/math/projet/g4.gr|graphe 4]] Gatépé
 +
*# [[silico:enseignement/m1/math/projet/g5.gr|graphe 5]]
 +
*# [[silico:enseignement/m1/math/projet/g6.gr|graphe 6]] Abdourahmane
 +
*# [[silico:enseignement/m1/math/projet/g7.gr|graphe 7]]
 +
*# [[silico:enseignement/m1/math/projet/g8.gr|graphe 8]]
 +
*# [[silico:enseignement/m1/math/projet/g9.gr|graphe 9]]
 +
*# [[silico:enseignement/m1/math/projet/g10.gr|graphe 10]] Océane
 +
*# [[silico:enseignement/m1/math/projet/g11.gr|graphe 11]] Magdalena
 +
*# [[silico:enseignement/m1/math/projet/g12.gr|graphe 12]]
 +
*# [[silico:enseignement/m1/math/projet/g13.gr|graphe 13]]  Naomi
 +
*# [[silico:enseignement/m1/math/projet/g14.gr|graphe 14]]
 +
*# [[silico:enseignement/m1/math/projet/g15.gr|graphe 15]]
 +
*# [[silico:enseignement/m1/math/projet/g16.gr|graphe 16]]
 +
*# [[silico:enseignement/m1/math/projet/g17.gr|graphe 17]]
 +
*# [[silico:enseignement/m1/math/projet/g18.gr|graphe 18]]
 +
*# [[silico:enseignement/m1/math/projet/g19.gr|graphe 19]] Tiphaine
 +
*# [[silico:enseignement/m1/math/projet/g20.gr|graphe 20]] Annabelle
 +
*# [[silico:enseignement/m1/math/projet/g21.gr|graphe 21]] Sandra
 +
*# [[silico:enseignement/m1/math/projet/g22.gr|graphe 22]]
 +
*# [[silico:enseignement/m1/math/projet/g23.gr|graphe 23]] Ilan
 +
*# [[silico:enseignement/m1/math/projet/g24.gr|graphe 24]]
 +
 +
<!-- ARCHIVES
 +
 +
 +
'''Projet 2018-19:'''
 +
* [[silico:enseignement/m1/math/projet/M1BBS_Math_Sujet_Projet_2018-19.html|Sujet du projet 2018-19]]
 +
* constitution des groupes (2 personnes par groupe) pour le projet : https://framadate.org/M1BBS-Groupes-Projet-Math
 +
* Les projets sont à rendre '''avant''' les fêtes de fin d'année
 +
* Graphe à analyser pour chaque groupe
 +
*# [[silico:enseignement/m1/math/projet/g1.gr|Groupe 1]]
 +
*# [[silico:enseignement/m1/math/projet/g2.gr|Groupe 2]]
 +
*# [[silico:enseignement/m1/math/projet/g3.gr|Groupe 3]]
 +
*# [[silico:enseignement/m1/math/projet/g4.gr|Groupe 4]]
 +
*# [[silico:enseignement/m1/math/projet/g5.gr|Groupe 5]]
 +
*# [[silico:enseignement/m1/math/projet/g6.gr|Groupe 6]]
 +
*# [[silico:enseignement/m1/math/projet/g7.gr|Groupe 7]]
 +
*# [[silico:enseignement/m1/math/projet/g8.gr|Groupe 8]]
 +
*# [[silico:enseignement/m1/math/projet/g9.gr|Groupe 9]]
 +
*# [[silico:enseignement/m1/math/projet/g10.gr|Groupe 10]]
 +
 +
 +
 +
*# [[silico:enseignement/m1/math/projet/Cleandb_Luca_2_A_1_1_65_Iso_Tr_1-CC1.gr|Groupe 1]]
 +
*# [[silico:enseignement/m1/math/projet/Cleandb_Luca_2_A_1_1_65_Iso_Tr_1-CC2.gr|Groupe 2]]
 +
*# [[silico:enseignement/m1/math/projet/Cleandb_Luca_2_A_1_1_65_Iso_Tr_1-CC3.gr|Groupe 3]]
 +
*# [[silico:enseignement/m1/math/projet/Cleandb_Luca_3_A_1_1_65_Iso_Tr_1-CC1.gr|Groupe 4]]
 +
*# [[silico:enseignement/m1/math/projet/Cleandb_Luca_4_A_1_1_65_Iso_Tr_1-CC1.gr|Groupe 5]]
 +
*# [[silico:enseignement/m1/math/projet/Cleandb_Luca_4_A_1_1_65_Iso_Tr_1-CC2.gr|Groupe 6]]
 +
*# [[silico:enseignement/m1/math/projet/Cleandb_Luca_5_A_1_1_65_Iso_Tr_1-CC1.gr|Groupe 7]]
 +
*# [[silico:enseignement/m1/math/projet/|Groupe 8]]
 +
*# [[silico:enseignement/m1/math/projet/|Groupe 9]]
 +
*# [[silico:enseignement/m1/math/projet/|Groupe 10]]
 +
 +
 +
'''Projet 2017-18:'''
 +
* [[silico:enseignement/m1/math/projet/M1BBS_Math_Sujet_Projet_2017-18.html|Sujet du projet 2017-18]]
 +
* constitution des groupes (2 ou 3 personnes par groupe) pour le projet : https://framadate.org/RlOS3KoUKgmRHM5s
 +
* Les projets sont à rendre '''avant''' le 4 Décembre
 +
* Graphe à analyser pour chaque groupe
 +
*# [[silico:enseignement/m1/math/projet/Cleandb_Luca_2_A_1_1_65_Iso_Tr_1-CC1.gr|Groupe 1]]
 +
*# [[silico:enseignement/m1/math/projet/Cleandb_Luca_2_A_1_1_65_Iso_Tr_1-CC2.gr|Groupe 2]]
 +
*# [[silico:enseignement/m1/math/projet/Cleandb_Luca_2_A_1_1_65_Iso_Tr_1-CC3.gr|Groupe 3]]
 +
*# [[silico:enseignement/m1/math/projet/Cleandb_Luca_3_A_1_1_65_Iso_Tr_1-CC1.gr|Groupe 4]]
 +
*# [[silico:enseignement/m1/math/projet/Cleandb_Luca_4_A_1_1_65_Iso_Tr_1-CC1.gr|Groupe 5]]
 +
*# [[silico:enseignement/m1/math/projet/Cleandb_Luca_4_A_1_1_65_Iso_Tr_1-CC2.gr|Groupe 6]]
 +
*# [[silico:enseignement/m1/math/projet/Cleandb_Luca_5_A_1_1_65_Iso_Tr_1-CC1.gr|Marie G.]]
 +
 +
 +
<big>'''Exam TP'''</big>
 +
* Exam TP 2017-18 : [[silico:enseignement/m1/math/cc/|Sujet et fichiers à utiliser]]
 +
 +
<!--* [[Media:M1 MABS BBS Math Memento.pdf|Memento]] de Régine André-Obrecht-->
 +
 +
<!--
 +
'''Contrôl continu décembre 2016'''
 +
* Sujet au format [[silico:enseignement/m1/math/cc/2016.Math.CC.html|HTML]] et [[silico:enseignement/m1/math/cc/2016.Math.CC.Rmd|Rmd]] et l'image nécessaire pour la compilation au niveau du dernier exercice [[silico:enseignement/m1/math/cc/CC.nfbl.png|CC.nfbl.png]]
 +
-->
-
'''Projet 2015-16:'''
 
-
* [[silico:enseignement/m1-mabs/math/projet/M1MABS_Math_Sujet_Projet_2015-16.html|Sujet du projet 2015-16]]
 
<!-- * [[M1 MABS CC Math 2012-12]] -->
<!-- * [[M1 MABS CC Math 2012-12]] -->
Line 156: Line 648:
-->
-->
-
'''Références'''
 
-
* ''Mathématiques pour les Sciences de la vie et de la Terre'' – C. David, S. Mustapha, F. Viens, N. Capron, edition Dunod
 
 +
 +
<!--
==== Harmonisation des Connaissances, partie Bioanalyse (EMBIA1IM) ====
==== Harmonisation des Connaissances, partie Bioanalyse (EMBIA1IM) ====
* Supports de cours
* Supports de cours
Line 166: Line 658:
* TD2 : [[Analyse de séquences I: recherche par similarité, alignements deux à deux]]
* TD2 : [[Analyse de séquences I: recherche par similarité, alignements deux à deux]]
* TD3 : [[Analyse de séquences II: alignements multiples et profils]]|
* TD3 : [[Analyse de séquences II: alignements multiples et profils]]|
-
<!--
+
 
* Contrôle Continu Décembre 2015  
* Contrôle Continu Décembre 2015  
[[Controle Continu 2015_2016]]
[[Controle Continu 2015_2016]]
Line 176: Line 668:
*Exam terminal-Janvier 2012: [[Examen terminal]]
*Exam terminal-Janvier 2012: [[Examen terminal]]
*Exam intermédiaire-Décembre 2011 : [[Examen intermédiaire]]
*Exam intermédiaire-Décembre 2011 : [[Examen intermédiaire]]
-
-->
+
 
* Exemples d'examen terminal
* Exemples d'examen terminal
2014-2015: Janvier 2015, [[Media:1415_CT_examen.pdf|Controle Terminal, session 1]]
2014-2015: Janvier 2015, [[Media:1415_CT_examen.pdf|Controle Terminal, session 1]]
 +
-->
==== Traitement de graphes et réseaux biologiques (EMBIA1KM) ====
==== Traitement de graphes et réseaux biologiques (EMBIA1KM) ====
-
 
-
<!--
 
-
'''Emploi du temps 2015-16'''
 
-
Les CM ont lieu en salle S20, les TP en salle 4TP4-P1.
 
-
{| class="wikitable"
 
-
!colspan="4"|EDT M1 Traitement de graphes et réseaux biologiques
 
-
|-
 
-
|                    || CM mardi 15h45-17h45 en S20    || TP mercredi 13h30-17h30 en 4TP4-P1
 
-
|-
 
-
| semaine 3 - 18.01    || RB CM1 Intro, notions et définitions ||
 
-
|-
 
-
| semaine 4 - 25.01    || RB CM2 représentation et premiers algo (DFS) ||
 
-
|-
 
-
| semaine 5 - 01.02    || RB CM3 algos (détection de cycles, tri topologique)        || RB TP1 Cytoscape, DFS Python
 
-
|-
 
-
| semaine 6 - 08.02    || RB CM4 algos (BFS, Dijkstra, Floyd-Warshall)        ||
 
-
|-
 
-
| semaine 7 - 15.02    || RB CM5 algos (MST Kruskall et Prim, Marches aléatoires, TribeMCL, Motif / Kavosh)        || RB TP2 BFS, plus courts chemins
 
-
|-
 
-
| semaine 8 - 22.01    || RB CM6 Dessin        ||
 
-
|-
 
-
| semaine 9 - 29.02    ||                      ||  RB TP3 dessin, librairie igraph
 
-
|-
 
-
| semaine 10 - 07.03  || YQ Partitionnement et détection de communautés        || YQ TP4 détection de communautés
 
-
|}
 
-
-->
 
'''Supports de cours'''
'''Supports de cours'''
* [[Media:Traitement_de_graphes_et_reseaux_biologiques.pdf|Support de cours]]
* [[Media:Traitement_de_graphes_et_reseaux_biologiques.pdf|Support de cours]]
 +
* [[Media:Traitement_des_graphes_et_reseaux_biologiques_communautes_v2019.pdf‎‎|Support de cours (communautés)]]
<!--
<!--
* [[Media:Traitement_des_graphes_et_reseaux_biologiques_communautes_v2013.pdf|Support de cours (communautés)]]
* [[Media:Traitement_des_graphes_et_reseaux_biologiques_communautes_v2013.pdf|Support de cours (communautés)]]
-
-->
 
-
* [[Media:Traitement_des_graphes_et_reseaux_biologiques_communautes_v2015.pdf‎|Support de cours (communautés)]]
 
 +
-->
'''Supports de TD/TP:'''  
'''Supports de TD/TP:'''  
-
* [[M1 MABS Graphes TP Visualisation et parcours en profondeur|TP]] Visualisation et parcours en profondeur
+
<!--* [[Media:M1Bioinfo.Graphes.TD.definitions.pdf|TD1]] Définitions-->
-
* [[M1 MABS Graphes TP Parcours en largeur - Plus court chemin|TP]] Parcours en largeur et plus court chemin
+
* [[M1 BBS Graphes TP Visualisation|TP1]] Visualisation et exploration de graphes
-
* [[M1 MABS Graphes TP Dessin et Introduction iGraph|TP]] Dessin de graphes et initiation à la librairie iGraph
+
* [[M1 BBS Graphes TP Librairie - Parcours de graphes|TP1-2-3]] Librairie python et parcours de graphes
-
* [[M1 MABS Graphes TP Recherche de communautés dans les graphes|TP]] Recherche de communautés dans les graphes
+
* [[M1 BBS Graphes TP Librairies R - igraph|TP4]] Librairies R - Prise en main igraph
 +
* [[M1 BBS Graphes TP Recherche de communautés dans les graphes|TP5]] Recherche de communautés dans les graphes
 +
* [[M1 BBS Graphes TP Dessin et Introduction iGraph|TP archivé]] Dessin de graphes et initiation à la librairie iGraph
 +
 
 +
 
 +
'''Projets 2020-21'''
 +
* [[M1 BBS Graphes - Projets|Enoncé du projet]]
-
'''Projets 2015-16'''
 
-
* [[M1 MABS Graphes - Projets|Enoncé du projet]]
 
'''Liens:'''
'''Liens:'''
-
* [http://cytoscape.org/ Cytoscape] (et [http://cytoscapeweb.cytoscape.org/ Cytoscape Web] mais un peu dépassé maintenant)
+
Logiciels
-
* [http://tulip.labri.fr/TulipDrupal/ Tulip]
+
* [http://cytoscape.org/ Cytoscape] (et [https://js.cytoscape.org/ librairie pour l'analyse et la visualisaiton])
 +
* [http://tulip.labri.fr/TulipDrupal/ Tulip] librairie C/C++ pour le traitement et la visualisation de graphes
* [https://gephi.org/ Gephi]
* [https://gephi.org/ Gephi]
-
* [http://igraph.org/ igraph]
+
 
 +
Librairies
 +
* [http://igraph.org/ igraph] R, python, ...
 +
* [http://networkx.github.io NetworkX] python
 +
* [https://graph-tool.skewed.de graph-tool] python
 +
* [https://www.bioconductor.org/packages/release/bioc/html/STRINGdb.html Bioconductor/STRINGdb] interface STRINGdb et R igraph
 +
 
 +
Serveurs & Banques
* [http://bioinformatics.ai.sri.com/ptools/ Pathway tools]
* [http://bioinformatics.ai.sri.com/ptools/ Pathway tools]
-
* [http://deim.urv.cat/~sgomez/radatools.php Radatools]
 
-
* [http://rsat.bigre.ulb.ac.be/rsat/index_neat.html NeAT]
 
* [http://www.metacyc.org/ METACYC]
* [http://www.metacyc.org/ METACYC]
* [http://string-db.org/ STRING]
* [http://string-db.org/ STRING]
-
* [https://www.bioconductor.org/packages/release/bioc/html/STRINGdb.html Bioconductor/STRINGdb] interface STRINGdb et R igraph
+
* [http://deim.urv.cat/~sgomez/radatools.php Radatools]
* [http://regulondb.ccg.unam.mx/ RegulonDb]
* [http://regulondb.ccg.unam.mx/ RegulonDb]
* [http://metanetx.org/ MetaNetX]
* [http://metanetx.org/ MetaNetX]
 +
 +
Formats
 +
* Format GraphML http://graphml.graphdrawing.org/ et http://graphml.graphdrawing.org/primer/graphml-primer.html
 +
 +
Autres
 +
* https://kateto.net/network-visualization Visu avec différents environnements et librairies
 +
* Visualisation de l'algorithme Floyd-Warshall https://www.cs.usfca.edu/~galles/visualization/Floyd.html
 +
* [http://exercism.io exercism.io] : améliorer son niveau de programmation dans différents langages (notamment R)
 +
* [http://rosalind.info rosalind] : apprentissage python en bioinformatique
'''Références'''
'''Références'''
Line 247: Line 733:
* <i>Pathway discovery in metabolic networks by subgraph extraction</i>, Faust <i>et al.</i>, Bioinformatics, 1211-1218, 2010. DOI:10.1093/bioinformatics/btq105
* <i>Pathway discovery in metabolic networks by subgraph extraction</i>, Faust <i>et al.</i>, Bioinformatics, 1211-1218, 2010. DOI:10.1093/bioinformatics/btq105
-
==== Fouille de données (EMBIA2DM) ====
 
<!--
<!--
-
{| class="wikitable"  
+
'''Emploi du temps 2015-16'''
-
!colspan="2"| Planning 2015-2016
+
Les CM ont lieu en salle S20, les TP en salle 4TP4-P1.
 +
{| class="wikitable"
 +
!colspan="4"|EDT M1 Traitement de graphes et réseaux biologiques
|-
|-
-
| date
+
|                   || CM mardi 15h45-17h45 en S20    || TP mercredi 13h30-17h30 en 4TP4-P1
-
| lieu
+
|-
|-
-
|Jeudi 15 oct 10h-12h
+
| semaine 3 - 18.01    || RB CM1 Intro, notions et définitions ||
-
| Einstein CM1 Intro
+
|-
|-
-
|Jeudi 22 oct 10h-12h
+
| semaine 4 - 25.01    || RB CM2 représentation et premiers algo (DFS) ||
-
| Einstein CM2 Classification 1
+
|-
|-
-
|Jeudi 12 nov 10h-12h
+
| semaine 5 - 01.02    || RB CM3 algos (détection de cycles, tri topologique)         || RB TP1 Cytoscape, DFS Python
-
| 1TP1-B08 CM3 Classification 2 (attention, changement de salle)
+
|-
|-
-
|Jeudi 19 nov 10h-12h
+
| semaine 6 - 08.02    || RB CM4 algos (BFS, Dijkstra, Floyd-Warshall)        ||
-
| Einstein CM4 Clustering 1
+
|-
|-
-
|Mercredi 25 nov 13h30-17h30
+
| semaine 7 - 15.02    || RB CM5 algos (MST Kruskall et Prim, Marches aléatoires, TribeMCL, Motif / Kavosh)         || RB TP2 BFS, plus courts chemins
-
| 4TP4-P1 TP1 Classification (Knime, R ; Naive Bayes, Decision Tree, k-nn, X-validation)
+
|-
|-
-
|Jeudi 26 nov 10h-12h
+
| semaine 8 - 22.01    || RB CM6 Dessin        ||  
-
| Einstein CM5 Clustering 2
+
|-
|-
-
|Mercredi 2 déc 13h30-17h30
+
| semaine 9 - 29.02    ||                       || RB TP3 dessin, librairie igraph
-
| 4TP4-P1 TP2 Classification (R, python ; LDA, k-nn)
+
-
|-
+
-
|Jeudi 3 déc 10h-12h
+
-
| Einstein CM6 Règles d'associations
+
-
|-
+
-
|Mercredi 9 déc 13h30-17h30
+
-
| 4TP4-P1 TP3 Classification (python ; Naive Bayes)
+
-
|-
+
-
|Mercredi 16 déc 13h30-17h30
+
-
| 4TP4-P1 TP4 clustering
+
|-
|-
-
|Jeudi 17 déc 10h-12h
+
| semaine 10 - 07.03  || YQ Partitionnement et détection de communautés        || YQ TP4 détection de communautés
-
| Einstein CM7 Règles d'associations
+
|}
|}
-->
-->
 +
 +
==== Fouille de données (EMBIA2DM) ====
 +
'''Support de cours:'''
'''Support de cours:'''
* [[Media:Data Mining - Intro.pdf|Introduction et Généralités]]
* [[Media:Data Mining - Intro.pdf|Introduction et Généralités]]
Line 295: Line 767:
* [[Media:Data Mining - Regles d Association.pdf|Règles d'association]]
* [[Media:Data Mining - Regles d Association.pdf|Règles d'association]]
-
'''Sujets de TD'''
+
'''Sujets de TD/TP'''
-
* [[M1 MABS BBS Data Mining TD Classification|TD]] Classification, validation croisée et clustering
+
* [[M1 BBS Data Mining TD Classification|TD]] Classification, validation croisée et clustering
-
<!--
+
-
* [[M1 MABS BBS Data Mining Naive Bayes|TD]] Classificateur Bayésien naïf
+
-
* [[M1 MABS BBS Data Mining TD KNIME|TD]] Classification et validation croisée
+
-
* [[M1 MABS BBS Data Mining k nearest neighbors|TD]] Classificateur k plus proches voisins
+
-
* [[M1 MABS BBS Data Mining Clustering|TD]] Clustering
+
-
-->
+
'''Projet'''
'''Projet'''
-
* [[M1 MABS BBS Data Mining Projet|Enoncé]] du projet
+
<!-- * [[M1 MABS BBS Data Mining Projet|Enoncé]] du projet -->
 +
* [[silico:enseignement/m1/datamining/projet/sujet.html|Sujet]]
 +
 
Line 327: Line 795:
* <i>Data Mining: Concepts and Techniques</i>, J. Han and M. Kamber, 2006.
* <i>Data Mining: Concepts and Techniques</i>, J. Han and M. Kamber, 2006.
* ''GENECODIS: a web-based tool for finding significant concurrent annotations in gene lists'', Carmona-Saez ''et al.'', Genome Biology, 2007.
* ''GENECODIS: a web-based tool for finding significant concurrent annotations in gene lists'', Carmona-Saez ''et al.'', Genome Biology, 2007.
 +
* Petit cours d'autodéfense intellectuelle, Normand Baillargeon, 2006
=== Master 1 - MEEF ===
=== Master 1 - MEEF ===
Line 334: Line 803:
'''Supports de TD :'''
'''Supports de TD :'''
* [[Media:1516_Gaulin_TD_PlantesDom.pdf|TD Plantes Domestiquees]]
* [[Media:1516_Gaulin_TD_PlantesDom.pdf|TD Plantes Domestiquees]]
 +
<!--
 +
 +
* [[Media:15_TD_Dom_CORRECTION.pdf|TD Plantes Domestiquees Correction]]
* [[Media:15_TD_Dom_CORRECTION.pdf|TD Plantes Domestiquees Correction]]
 +
-->
-
'''Supports de Cours :'''
+
<!--
-
* [[Media:1516_PlantesDom.pdf|CM Plantes Domestiquees]]
+
* [[Media:1617_PlantesDomes.pdf|CM Plantes Domestiquees]]
 +
 
 +
 
 +
-->
== Master 2 ==
== Master 2 ==
 +
=== Master 2P Diagnostic moléculaire en microbiolgy ===
 +
=====Supports de cours =====
 +
* [[Media:annotation2_M2Diag_2021.pdf|Annotation génomes bactériens (Gwennaele Fichant)]]
 +
<!-- * [[Media:Phylogenie_Definitions_2018_M2Diag.pdf|Définitions en phylogénie (Gwennaele Fichant)]] -->
 +
* [[Media:Introduction_Phylogenie_2021_M2Diag.pdf|Introduction à la reconstruction phylogénétique (Gwennaele Fichant)]]
 +
 +
=====Tutoriels de TP=====
 +
*[[silico:enseignement/m1-bioinfo/BG/TD_annotation/Tutorial_annotation_v1_2019.html|Annotation d'un fragment génomique bactérien]]
 +
 +
* [[silico:enseignement/m1-mabs/EvolMol/TD1/index.html|Analyse évolutive de la cascade de régulation de la compétence chez les Streptocoques]]
 +
* [[Media:seaview4.zip|seaview à télécharger pour Windows]]
 +
* [[Media:seaview4-64.tar.gz|seaview à télécharger pour Linux]]
 +
* [[Media:Introduction_competence_2020.pdf|Petit topo d'introduction sur la régulation de la compétence chez ''S. pneumoniae'']]
 +
 +
* [[silico:enseignement/m2pro-diag/Bioinfo/TD_16srRNA/16SRNA_Tutorial_de _BioInformatique.htm|Identification des bactéries à l'aide de l'ARNr 16S]]
=== Master 2 - Bioinformatique et Biologie des Systèmes ===
=== Master 2 - Bioinformatique et Biologie des Systèmes ===
-
* [[silico:enseignement/m2pro-bioinfo/Annotation.html|TD Annotation Artemis]]
+
<!-- * [[silico:enseignement/m2pro-bioinfo/Annotation.html|TD Annotation Artemis]]
* Génome de ''E. coli'' de 2002 [[silico:enseignement/m2pro-bioinfo/EcolA01.embl|EcolA01.embl]]
* Génome de ''E. coli'' de 2002 [[silico:enseignement/m2pro-bioinfo/EcolA01.embl|EcolA01.embl]]
 +
-->
 +
===== Atelier système =====
* [[M2BBS - Atelier Système]]
* [[M2BBS - Atelier Système]]
-
==== Intégration de Données Hétérogènes - Partie R. Barriot ====
+
==== Atelier Chipseq ====
 +
* [[silico:enseignement/m2BBS/ChipSeq/TP_CHIPSEQ_2019_M2Bioinfo_FolderEtudiants.tar.gz|données TP]]
-
* [[Media:M2BBS - Integration de Donnees Heterogenes.pdf|Support de cours]]
+
====Atelier Galaxy ====
 +
 
 +
* http://genoweb.toulouse.inra.fr/~formation/8_Galaxy_Admin/2019/
 +
 
 +
==== UE Communication ====
 +
 
 +
=====liste des publications à présenter en préparation des ateliers:=====
 +
'''Chaque publication sera choisie par deux étudiant(e)s. La présentation de la publication est personnelle. Donc chaque personne préparera une présentation powerpoint (ou pdf), diapositives en anglais, de 15 minutes qui sera suivie de 10 minutes de questions. La présentation et les questions se feront en français. Attention, ne pas oublier de récupérer et de lire les supplementary data qui sont aussi important pour la compréhension de l'article. La présentation devra faire ressortir la problématique abordée (question posée et contexte), la démarche bioinformatique adoptée, les résultats sous forme synthétisée avec choix pertinent des figures pour illustrer votre propos et la conclusion/discussion.
 +
'''
 +
 
 +
* '''Atelier Etude du métabolisme'''
 +
** Article 1 :
 +
*** [[Media:Aurich_et_al_2014.pdf|Prediction of intracellular metabolic states from extracellular metabolomic data]]
 +
*** Supplementary information à récupérer sur https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4419158/
 +
** Article 2 :
 +
*** [[Media:Shlomi_et_al_2009.pdf|Predicting metabolic biomarkers of human inborn errors of metabolism]]
 +
*** Supplementary information à récupérer sur https://www.embopress.org/doi/full/10.1038/msb.2009.22
 +
 
 +
* '''Atelier ChipSeq'''
 +
** Article 1 :
 +
*** [[Media:GenomeBiol2008.pdf|Model-based Analysis of ChIP-Seq (MACS)]]
 +
*** [[Media:MACS_Sup_data.pdf |Supplementary information]]
 +
** Article 2 :
 +
*** [[Media:Buenrostro_2018.pdf|Integrated Single-Cell Analysis Maps the Continuous Regulatory Landscape of Human Hematopoietic Differentiation]]
 +
*** Supplementary information à récupérer sur https://www.sciencedirect.com/science/article/pii/S009286741830446X?via%3Dihub
 +
 
 +
* '''Atelier Phylogénomique'''
 +
** Article 1 :
 +
*** [[Media:OrthoGNC.pdf| OrthoGNC: A Software for Accurate Identification of Orthologs Based on Gene Neighborhood Conservation]]
 +
*** [[Media:OrthoGNC_sup_data.zip| Supplementary information à lire impérativement]]
 +
** Article 2
 +
***[[Media:Ali_et_al_2019.pdf|Identifying Clusters of High Confidence Homologies in Multiple Sequence Alignments]]
 +
 
 +
* '''Atelier Paléogénomique'''
 +
** Article 1 :
 +
*** [[Media:Fernandes_et_al_2021.pdf|TKGWV2: An ancient DNA relatedness pipeline for ultra-low coverage whole genome shotgun data]]
 +
 
 +
* '''Atelier Modélisation'''
 +
** Article 1 :
 +
*** [[Media:Weyder_et_al_2018.pdf|Dynamic Modeling of Streptococcus pneumoniae Competence Provides Regulatory Mechanistic Insights Into Its Tight Temporal Regulation]]
 +
*** Supplementary information à récupérer sur https://www.frontiersin.org/articles/10.3389/fmicb.2018.01637/full#supplementary-material
 +
** Article 2 :
 +
*** [[Media:Li_et_al_2008.pdf|A Quantitative Study of the Division Cycle of Caulobacter crescentus Stalked Cells]]
 +
*** Supplementary information à récupérer sur https://journals.plos.org/ploscompbiol/article?id=10.1371/journal.pcbi.0040009
 +
 
 +
 
 +
===== Calendrier des présentations d'articles =====
 +
 
 +
{| class="wikitable"
 +
!colspan="5"|EDT présentation des articles (les noms sont donnés pour rappel mais ordre de passage indifférent)
 +
|-
 +
|lundi 27septembre 9h30-11h30 :
 +
|articles Atelier ChipSeq
 +
|article 1 : 9H30-10h30 (Mathias, Nadine)
 +
|article 2 : 10h30-11h30 (Oussama, Marine)
 +
|-
 +
|lundi 27septembre 11h45-12h45 :
 +
|article Atelier ¨Paléogénomique
 +
|article 1 : 11h45-12h45 (Natacha, Hugo)
 +
|-
 +
|lundi 27septembre 14h-16h :
 +
|articles Atelier Phylogénomique
 +
|article 1 : 14h-15h (Etienne, Sandro)
 +
|article 2 : 15h-16h (Jeanne, Nolan)
 +
|-
 +
|mardi 28septembre 10h30-12h30 :
 +
|article Atelier Etude du Métabolisme
 +
|article 1 : 10H30-11h30 (Gabryelle, Maïna)
 +
|article 2 : 11h30-12h30 (Victoria, Lou)
 +
|-
 +
|mardi 28 septembre 14h-16h30 :
 +
|articles Atelier Modélisation
 +
|article 1 : 14h-15h (Julien, Ludovic)
 +
|article 2 : 15h-16h (Sophia, Antoine)
 +
|Commentaires : 16h-16h30
 +
|}
 +
 
 +
==== Gestion des données non structurées et applications post-génomiques  ====
 +
 
 +
===== IDH 1ère partie Karen Pinel-Sauvagnat et Gilles Hubert =====
 +
Supports séance 1 :
 +
 
 +
* [[Media:M2BBS_IDH_Introduction.pdf |Cours - Introduction]]
 +
 
 +
* [[Media:M2BBS_IDH_Document.pdf |Cours - MongoDB]]
 +
 
 +
* [[Media:M2BBS_IDH_CasEtude.pdf |Cas d'étude (commun MongoDB et Neo4J)]]
 +
 
 +
* [[Media:M2BBS_IDH_TDTP_Mongo.pdf |TD/TP - MongoDB]]
 +
 
 +
Supports séance 2 :
 +
 
 +
* [[Media:M2BBS_IDH_Graphe.pdf |Cours - Neo4J]]
 +
 
 +
* [[Media:M2BBS_IDH_TD_Neo4J.pdf |TD - Neo4J]]
 +
 
 +
* [[Media:M2BBS_IDH_TP_Neo4J.pdf |TP1 - Prise en main Neo4J]]
 +
 
 +
* [[Media:M2BBS_IDH_InstallNeo4J.pdf | Ressource Neo4J - Installation de Neo4J Desktop]]
 +
 
 +
* [[Media:M2BBS_IDH_CypherRefCard.pdf | Ressource Neo4J - Cypher RefCard]]
 +
 
 +
Supports séance 3 :
 +
 
 +
* [[Media:M2BBS_IDH_Projet_Neo4J.pdf |TP2 - Projet Neo4J]] '''à rendre au plus tard le 19/09 par mail à karen.sauvagnat@irit.fr et gilles.hubert@irit.fr'''
 +
 
 +
* [https://filesender.renater.fr/?s=download&token=d041fcb9-7671-4375-99dd-3fad1e1f1ef2 Téléchargement données sources Projet Neo4J]
 +
 
 +
===== IDH 2ème partie Roland Barriot =====
 +
 
 +
 
 +
Page dédiée → [[M2BBS GDNS-APG]]
 +
 
 +
<!--
 +
 
 +
Supports de cours :
 +
 
 +
* [[Media:M2BBS - Integration de Donnees Heterogenes - Generalites.pdf|Approches]]
 +
* [[Media:M2BBS - Integration de Donnees Heterogenes - Enrichissement.pdf|Enrichissement]]
 +
* [[Media:M2BBS - Integration de Donnees Heterogenes - Priorisation.pdf|Fusion de données et priorisation de gènes candidats]]
 +
 
 +
Sujet de TD/TP :
* [[M2BBS - IDH|Mise en oeuvre]]  
* [[M2BBS - IDH|Mise en oeuvre]]  
 +
 +
Description du projet :
* [[M2BBS Integration de Donnes Heterogenes - Projets|Projets IDH]]
* [[M2BBS Integration de Donnes Heterogenes - Projets|Projets IDH]]
 +
-->
 +
 +
<!--
 +
==== Atelier Génétique Satistique - S. Boitard ====
 +
Support de cours et TD:
 +
* [[Media:coal_cours.pdf|Coalescence : principe et bases théoriques]] '''
 +
* [[Media:coal_td.pdf|TD de génétique des populations]] '''
 +
* [[Media:tp_struc.pdf|TP : Diversité génétique d’une population structurée]] '''
 +
* [[Media:Mol_Biol_Evol-1999-Pritchard-1791-8.pdf|article : investigation de l'histoire démographique du chromosome Y par analyse des loci microsatellite]] '''
 +
* [[Media:cours_tp_hapFLK.pdf|cours et TP de détection de locus sous sélection positive]] '''
 +
 +
'''TP :'''
 +
*[[Media:tp_coal.pdf|TP : simulations de données génétiques par coalescence fichier format pdf]] '''
 +
*[[silico:enseignement/m2BBS/Genet_Stat/tp_coal.html|TP : simulations de données génétiques par coalescence fichier format html]]
 +
*[[Media:tp_abc.pdf|TP estimation de paramètres par une approche ABC]] '''
 +
*[[https://github.com/willyrv/BioInfoCours]] autres documents
 +
-->
 +
 +
====Atelier Phylogénomique====
 +
Intervenants : Claire Hoede et Yves Quentin
 +
 +
[http://silico.biotoul.fr/p/Atelier_Phylog%C3%A9nomique Atelier de Phylogénomique]
 +
 +
<!--
 +
===== Biologie des Systèmes - R. Barriot =====
 +
* [[Media:GRNs.pdf|Réseaux de régulation]] '''
 +
* [[M2 BBS TP GRNs]]
 +
-->
 +
 +
==== Biologie des Systèmes - G. Czaplicki ====
 +
 +
* [[Media:document_GC.pdf|Support de cours]] '''
 +
 +
Fichiers avec les codes :
 +
* [[Media:banana.m|banana.m]] '''
 +
* [[Media:ftest.m|ftest.m]] '''
 +
* [[Media:Rate.m|Rate.m]] '''
 +
* [[Media:SMarquardt.m|SMarquardt.m]] '''
 +
* [[Media:compet.dat|compet.dat]] '''
 +
 +
==== Biologie des Systèmes - G. Fichant ====
 +
Support de cours:
 +
* [[Media:Intro_BioSyst_2017.pdf|Introduction to system biology]] '''
 +
* [[Media:Rappel_enzymo_v1.pdf|Petit rappel enzymologie]]'''
 +
* [[Media:SCAN_rappel_enzymo.pdf|Complément rappel enzymologie]]'''
 +
* [[Media:Petri_net_2020.pdf|Introduction to Petri net models]]'''
 +
* [[Media:Modele_stochastique.pdf|Introduction to stochastic simulation]]'''
 +
* [[Media:parameter_estimation_2019.pdf|Introduction parameter estimation]]'''
 +
* [[Media:Intro_PL_2020.pdf|Introduction to Piece-wise linear differential equation models]]'''
 +
* [[Media:Model_analysis.pdf| System dynamic analyses ]]'''
 +
* [[Media:SBML.pdf| Bref introduction au standard SBML ]]'''
 +
 +
<!--* [[Media:network_motifs.pdf|Two and three nodes network motifs in transcriptional networks]]'''-->
 +
 +
<!-- * [[Media:parameter_estimation.pdf| Parameter estimation (M. Weyder)]]''' -->
 +
 +
'''TP :'''
 +
* [[Media:CopasiUserguide-20100803-1.pdf|Copasi user guide]]
 +
* [[Media:Aide_Copasi.pdf|mnémo pour prise en main de Copasi plus simulation avec R]]
 +
* Lien vers le site de Snoopy : https://www-dssz.informatik.tu-cottbus.de/DSSZ/Software/Snoopy
 +
 +
 +
*'''TP1 : modeling of the psp response when cell envelop  is damaged'''
 +
** [[Media:TP_psp_response.pdf|Short description the biological process]]
 +
<!--** [[Media:Modele_psp_extended_PN.xpn|Modèle corrigé du réseau qualitatif]] -->
 +
<!--** [[Media:Modele_psp_save_essai_2019_modif_constante.spn|Modèle corrigé du réseau stochastique]]-->
 +
 +
<!-- ** [[Media:constante_stochastic_2017-18.png|constantes stochastiques]]
 +
<!--** [[Media:Toni_et_al_2011.pdf|article support]]  -->
 +
<!--** [[Media:constante_stochastic_2017-18.png|constantes stochastiques]] -->
 +
<!-- ** [[Media:modele_psp_save_2017-18.spn|Modèle stochastique corrigé]] -->
 +
<!--** [[Media:psp_system_dm.txt|membrane data]]
 +
** [[Media:psp_system_hBCA.txt|hBCA data]]
 +
** [[Media:psp_system_olg.txt|olg data]]
 +
** [[Media:psp_system_hBCAF.txt|hBCAF data]]
 +
** [[Media:psp_system_hBcCcA.txt|hBcAcCc data]]-->
 +
 +
 +
*'''TP2 : modeling of the repressilator:'''
 +
** [[Media:tp_repressilator_2020.pdf|Short description of the repressilator regulation]]
 +
** [[Media:repressilator_continu_2018_time_serie_500.csv|protein time series data]]
 +
<!--** [[Media:repressilator_stochastique_2019.spn|Modèle corrigé du réseau stochastique]]
 +
** [[Media:repressilator_continu_2020.cpn|Modèle corrigé du réseau continu avec Snoopy]]-->
 +
 +
<!-- ** [[Media:repressilator_prot.cps|Modèle corrigé Copasi]] -->
 +
<!-- ** [[Media:repressilator.Rmd|script R pour intégration ODE]]-->
 +
 +
<!-- ** [[Media:constante_stochastique.png|stochastic constant file]]
 +
** [[Media:constante_continu.png|ODE parameter file]] -->
 +
 +
*'''TP3 : modeling phosphate regulation in enterobacteria:'''
 +
** [[Media:TP_phosphate_new_2018.pdf|Short biological description of the phosphate regulation]]
 +
<!--** [[Media:Modele_stochastique_switch.spn|Modèle corrigé du réseau stochastique]]-->
 +
<!--** [[Media:PN_extended_phosphate.xpn| Modèle corrigé du réseau qualitatif]]-->
 +
 +
<!-- ** [[Media:PN_extended_phosphate.xpn|Modèle "extended Petri Net" corrigé]]-->
 +
<!-- ** [[Media:modele_stochastique_switch.spn|Modèle stochastique corrigé]]-->
 +
 +
<!-- *'''TP4 : modeling of the regulation of lactose operon :'''
 +
** [[Media:operon_lactose_description_2018.pdf|'''TP à rendre''' Short biological description of the lactose operon regulation]]]-->
 +
 +
<!--** [[Media:operon_lac_2018_last.spn|'''Modèle stochastique corrigé''']]
 +
** [[Media:res_stochastique_lactose_3pics.PNG|'''Capture écran lactose input''']]
 +
** [[Media:res_stochastique_prot_3pics.PNG| '''Capture écran comportement des protéines''']]-->
 +
<!-- ** [[Media:constantes_2017.txt|stochastic constant file]]
 +
** [[Media:Constante_parameter_lactose_stochastique_2017.PNG|screen shot of the constant definition in the model]]-->
=== Master 2 - [http://sciences-vegetales.univ-tlse3.fr/presentation-m2-adam-609174.kjsp?RH=1449138073206&RF=1450299526893 ADAM] (Adaptation, Développement et Amélioration des plantes en présence de Microorganismes)===
=== Master 2 - [http://sciences-vegetales.univ-tlse3.fr/presentation-m2-adam-609174.kjsp?RH=1449138073206&RF=1450299526893 ADAM] (Adaptation, Développement et Amélioration des plantes en présence de Microorganismes)===
Line 362: Line 1,085:
'''Documents, partie E. Gaulin'''
'''Documents, partie E. Gaulin'''
-
* [[M2R_BV|Clonage in silico]]
+
* [[M2R_ADAM|Clonage in silico_BenchLing]]
 +
 
 +
* [[M2R_BV|Clonage in silico_pDRAW]]
 +
 
<!--
<!--
 +
 +
-------------------------------------------------------
 +
'''Examen 2021-2022'''
 +
 +
 +
'''Partie E. Gaulin'''
 +
 +
Veuillez trouver ci-dessous, la séquence fasta de l'ADNc SSP1256 que l'on souhaite cloner dans le vecteur de destination pCAMBIA
 +
 +
'''>ADNc_SSP1256'''
 +
 +
ACTTCCAAATTCTAGTATATGTAATCCTTTT
 +
GTTCGGGTTCATGATCGAATTCCAAAGAGTGGAAAACAAGCAAAAGGTTAAATATACATG
 +
CCATTTTTGGAGCTTTCGAGCTCATAACACAGGTGAGCGCGACGAATGGATCCCTCGCTA
 +
ATAACATCATGGTCGTGGGCGCCGTCCTTGCGGCGCTCGTCGCCGGCGGGTCGTGCGGGC
 +
CCCCGAAGGTGCCACCCGGCCCCAACATCACCACCAACTACAACGGCAAGTGGCTCACCG
 +
CTAGGGCCACCTGGTACGGTCAGCCCAACGGTGCCGGCGCTCCTGACAACGGCGGTGCGT
 +
GCGGGATCAAGAACGTGAACCTGCCACCCTACAGCGGCATGACGGCGTGCGGCAACGTCC
 +
CCATCTTCAAGGACGGCAAGGGCTGCGGCTCATGCTACGAGGTGAGATGCAAGGAAAAAC
 +
CTGAGTGCTCGGGCAATCCAGTCACGGTGTACATCACTGACATGAACTACGAACCTATCG
 +
CTCCCTACCACTTCGACTTGAGCGGCAAGGCCTTCGGCTCCCTGGCAAAGCCCGGGCTCA
 +
ACGACAAGATTCGCCACTGCGGCATCATGGACGTCGAGTTCAGAAGGGTGCGATGCAAGT
 +
ACCCCGCCGGGCAGAAGATCGTGTTCCACATCGAGAAGGGCTGCAACCCCAACTACCTGG
 +
CCGTGCTGGTGAAGTATGTGGCGGACGACGGCGACATCGTGCTGATGGAAATCCAGGACA
 +
AGTTGTCGGCTGAGTGGAAGCCCATGAAGCTCTCTTGGGGCGCCATCTGGAGGATGGACA
 +
CTGCCAAGGCGCTCAAGGGCCCCTTCTCCATCCGCCTCACCAGCGAGTCCGGCAAGAAGG
 +
TCATCGCCAAAGACGTCATCCCGGCGAACTGGAGACCCGATGCCGTCTACACTTCCAACG
 +
TCCAATTTTACGTAACTTTGAATTCCCTTCGATTCATCCGGCACAGCGGGCTATGGACCT
 +
TCAGCAGCAAGCTAATTAAGTTGGCAGCATGCACCGCTAACCTTATATACTACTGAGACT
 +
TCCAAATTCTAGTATATGTAATCCTTTTGTTCGGGTTCATGATCGAATTCCAAAGAGTGG
 +
AAAACAAGCAAAAGGTTAAATATACATGCCATTTTTGGAAGCTTGGCTTTCGAGGGTACC
 +
CCTGATAGTT
 +
 +
 +
 +
'''Partie C. Mathé'''
 +
* [http://genoweb.toulouse.inra.fr/~mathe/M2RBV/Exam_Blast.htm Lien vers un BLAST sauvegardé]
 +
 +
 +
 +
 +
-------------------------------------------
 +
 +
 +
'''Examen 2018-2019'''
 +
 +
'''Partie C. Albenne'''
 +
 +
*[[Media:EXPB1b.doc|EXPB1]]
 +
*[[Media:2hcz.dsv|Structure]]
 +
 +
 +
'''Partie E. Gaulin'''
 +
* [[M2R|Cartes et Sites de Restriction]]
 +
 +
'''Partie C. Mathé'''
 +
* [http://genoweb.toulouse.inra.fr/~mathe/M2RBV/Exam_Blast.htm Lien vers un BLAST sauvegardé]
 +
 +
'''Partie C. Albenne'''
 +
*[[Media:M2R_2018-Albenne.pdf|Sujet C Albenne]]
 +
 +
 +
*[[Media:EXPB1.doc|EXPB1]]
 +
*[[Media:2hcz.dsv|Structure]]
 +
 +
 +
 +
---------------------------------------------
 +
 +
 +
'''Examen 2017, partie E. Gaulin''' <br>
 +
 +
'''Documents, sujet C Albenne'''
 +
*[[Media:M2R_2017-Albenne.pdf|Sujet C Albenne]]
 +
'''Examen 2016, partie E. Gaulin''' <br>
'''Examen 2016, partie E. Gaulin''' <br>
Line 372: Line 1,173:
'''Documents, partie E. Gaulin'''
'''Documents, partie E. Gaulin'''
* [[M2R|Cartes et Sites de Restriction]]
* [[M2R|Cartes et Sites de Restriction]]
-
-->
+
 
-
'''Documents, partie C. Mathé'''
+
-
* [http://snp.toulouse.inra.fr/~mathe/M2RBV/Exam_Blast.htm Lien vers un BLAST sauvegardé]
+
'''Documents, partie C. Albenne'''
'''Documents, partie C. Albenne'''
* [[Media:EXP1.doc|Sequence fasta EXPB1]]
* [[Media:EXP1.doc|Sequence fasta EXPB1]]
* [[Media:2HCZ.pdb|Structure PDB]]
* [[Media:2HCZ.pdb|Structure PDB]]
 +
 +
-------------------------------------------------
 +
 +
==== Biologie Computationnelle (2019) ====
 +
 +
* [[M2R_ADAM|In silico cloning]]
 +
 +
-->
 +
 +
= Culture =
 +
 +
* Une histoire de tout ou presque... Bill Bryson, Payot, coll. "Petite Bibliothèque Payot" n° 851, 2012 (ISBN: 9782228907576)
 +
* Norman Baillargeon - Petit cours d'autodéfense intellectuelle, Éditions Lux, collection Instinct de Liberté, 2005. (ISBN: 2-895960-44-5)
 +
* Faire l'économie de la haine, Alain Deneault, 2018, Ecosociete Eds, coll. Polemos
 +
* Comment tout peut s'effondrer. Petit manuel de collapsologie à l'usage des générations présentes. 2015. Pablo Servigne, :Raphaël Stevens. seuil
 +
* Les sentiers de l'utopie, I. Fremeaux et J. Jordan, 2012.
= F.A.Q. =
= F.A.Q. =

Current revision as of 10:59, 29 November 2021


Contents

Licence 2 et 3 Biologie

Bioinformatique - Option L2-L3 2B2M-BCP-BOPE

UE en option avec différents codes :

  • L2 2B2M : EDSVB4IM
  • L2 BCP : EDSVA4HM
  • L2 BOPE : EDSVC4MM
  • L3 BOPE : ELSVC6JM

Emploi du temps 2019-20

Aussi disponible sur https://calendar.google.com/calendar/embed?src=lic.bioinfo%40gmail.com&ctz=Europe/Paris


Les groupes de TD et TP 2019-20 sont disponibles sur moodle : https://moodle.univ-tlse3.fr/course/view.php?id=2518


EDT L2-L3 2B2M-BCP-BOPE Bioinformatique
CM TD TP
semaine 03 - 17/01 13h30-15h40 R. Barriot - Bioinfo générale (lien zoom sur moodle)
15h50-18h00 F. Delavoie - Imagerie
semaine 04 - 24/01 13h30-15h50 groupes TP en U6-104, 105 et 106
semaine 05 - 31/01 13h30-15h40 R. Barriot - Bases de Données 15h50-18h00 groupe TD1 en U6-205
18h10-20h20 groupe TD2 en U6-205
semaine 06 - 07/02 13h30-15h40 groupe TP en U6-104

15h50-18h00 groupe TP en U3-204
18h10-20h20 groupe TP en U6-104

semaine 07 - 14/02 13h30-15h40 M. Bonhomme
semaine 08 - 21/02 13h30-15h50 groupes TP en U6-104, 105 et 106
semaine 09 - 28/02
semaine 10 - 07/03 13h30-15h30 Contrôle avec report
semaine 11 - 14/03 13h30-15h40 Gwennaele Fichant - Modélisation et Biologie des systèmes
semaine 12 - 21/03 13h30-15h40 groupe TP en 4TP4-P15

15h50-18h00 groupe TP en 4TP4-P15
18h10-20h20 groupe TP en 4TP4-P15

semaine 13 - 28/03 13h30-15h40 groupe TD1 en U6-215

15h50-18h00 groupe TD2 en U6-215

semaine 14 - 04/04 13h30-15h40 groupe TP en 4TP2-M6

15h50-18h00 groupe TP en 4TP2-M6
18h10-20h20 groupe TP en 4TP2-M6

semaine 15 - 11/04 13h45-15h15 Contrôle terminal anticipé





Supports de cours

Sujets de TD/TP

BioAnalyse L3 BCP (ELSV6CM1)

2021_2022 Planning des Enseignements ... A venir

Toutes les informations relatives à l'UE de Bioanalyse seront également disponibles dans l'espace dédié sur Moodle


Supports de Cours


TPs en salle

Annales & Corrigés

BioAnalyse L3 2B2M

TPs

Licence Pro GeBAP

Schéma de sélection et productions de semences

  • TP Analyse de QTL

Licence 3 Biologie des Organismes des populations et Ecosystemes (BOPE)

Du génome à la sélection des plantes (ELSVC5EM)


Master

Master 1

Master 1 - Bioinformatique et Biologie des Systèmes + Biologie Végétale ADAM

Traitement de données biologiques (EMBIA1FM)

Supports de cours :

Supports de TD/TP :


Liens

Génétique Evolutive et Quantitative (EMBIA1GM)

Support de cours:

Supports de TD/TP :

Génomique Evolutive et Phylogénie

Supports de TD/TP :

Medicago SNPs sequences
Drosophile sequences
Primates lysozymes sequences

Master 1 - Bioinformatique et Biologie des Systèmes + Biotechnologies

Evolution Moléculaire (EMBIA2EM)

Supports de cours :


Support TP :




Support TD :



Master 1 - Bioinformatique et Biologie des Systèmes


Bioinformatique pour la Génomique (EMBIA1DM)

Supports de cours :

Tutoriels de TP :

Aide pour la réalisation du projet annotation

Contrôle continu :

  • Rapport de TP sur le design d'un HMM à rendre au plus tard le lundi 11 octobre 2021. M'envoyer par courrier le rapport en format pdf. Merci aussi de joindre au mail, uniquement si vous avez fait tourner tourner vous-même les programmes show_emfit et show_viterbi, le fichier en format texte comportant votre modèle avant estimation des probabilités et celui après estimation des probabilités.


Mathématique pour la Biologie (EMBIA1EM)

Sujets de TP :

  • TD Calcul matriciel
  • TD ACP
  • TD Modélisation
  • TD Probabilités


Liens :

  • http://exercism.io : améliorer son niveau de programmation dans différents langages (notamment R)

Références

  • Mathématiques pour les Sciences de la vie et de la Terre – C. David, S. Mustapha, F. Viens, N. Capron, edition Dunod

Projet 2021-22 :





Traitement de graphes et réseaux biologiques (EMBIA1KM)

Supports de cours

Supports de TD/TP:

  • TP1 Visualisation et exploration de graphes
  • TP1-2-3 Librairie python et parcours de graphes
  • TP4 Librairies R - Prise en main igraph
  • TP5 Recherche de communautés dans les graphes
  • TP archivé Dessin de graphes et initiation à la librairie iGraph


Projets 2020-21


Liens: Logiciels

Librairies

Serveurs & Banques

Formats

Autres

Références

  • Introduction to Algorithms, Corsen, Leiserson and Rivest, MIT Press and McGraw-Hill
  • Detection of Functional Modules From Protein Interaction Networks, Pereira-Leal, Enright and Ozounis, PROTEINS: Structure, Function, and Bioinformatics, 49-57, 2004.
  • An efficient algorithm for large-scale detection of protein families, Enright, Van Dongen and Ozounis, Nucleic Acids Research, 1575-84, 2002 PMID:11917018
  • Kavosh: a new algorithm for finding network motifs, Kashani et al., BMC Bioinformatics, 2009. DOI:10.1186/1471-2105-10-318
  • Pathway discovery in metabolic networks by subgraph extraction, Faust et al., Bioinformatics, 1211-1218, 2010. DOI:10.1093/bioinformatics/btq105


Fouille de données (EMBIA2DM)

Support de cours:

Sujets de TD/TP

  • TD Classification, validation croisée et clustering

Projet


Liens

Références

  • Data Mining: Concepts and Techniques, J. Han and M. Kamber, 2006.
  • GENECODIS: a web-based tool for finding significant concurrent annotations in gene lists, Carmona-Saez et al., Genome Biology, 2007.
  • Petit cours d'autodéfense intellectuelle, Normand Baillargeon, 2006

Master 1 - MEEF

Sciences de la Vie (EE7BSVFM)

Supports de TD :


Master 2

Master 2P Diagnostic moléculaire en microbiolgy

Supports de cours
Tutoriels de TP

Master 2 - Bioinformatique et Biologie des Systèmes

Atelier système

Atelier Chipseq

Atelier Galaxy

UE Communication

liste des publications à présenter en préparation des ateliers:

Chaque publication sera choisie par deux étudiant(e)s. La présentation de la publication est personnelle. Donc chaque personne préparera une présentation powerpoint (ou pdf), diapositives en anglais, de 15 minutes qui sera suivie de 10 minutes de questions. La présentation et les questions se feront en français. Attention, ne pas oublier de récupérer et de lire les supplementary data qui sont aussi important pour la compréhension de l'article. La présentation devra faire ressortir la problématique abordée (question posée et contexte), la démarche bioinformatique adoptée, les résultats sous forme synthétisée avec choix pertinent des figures pour illustrer votre propos et la conclusion/discussion.


Calendrier des présentations d'articles
EDT présentation des articles (les noms sont donnés pour rappel mais ordre de passage indifférent)
lundi 27septembre 9h30-11h30 : articles Atelier ChipSeq article 1 : 9H30-10h30 (Mathias, Nadine) article 2 : 10h30-11h30 (Oussama, Marine)
lundi 27septembre 11h45-12h45 : article Atelier ¨Paléogénomique article 1 : 11h45-12h45 (Natacha, Hugo)
lundi 27septembre 14h-16h : articles Atelier Phylogénomique article 1 : 14h-15h (Etienne, Sandro) article 2 : 15h-16h (Jeanne, Nolan)
mardi 28septembre 10h30-12h30 : article Atelier Etude du Métabolisme article 1 : 10H30-11h30 (Gabryelle, Maïna) article 2 : 11h30-12h30 (Victoria, Lou)
mardi 28 septembre 14h-16h30 : articles Atelier Modélisation article 1 : 14h-15h (Julien, Ludovic) article 2 : 15h-16h (Sophia, Antoine) Commentaires : 16h-16h30

Gestion des données non structurées et applications post-génomiques

IDH 1ère partie Karen Pinel-Sauvagnat et Gilles Hubert

Supports séance 1 :

Supports séance 2 :

Supports séance 3 :

  • TP2 - Projet Neo4J à rendre au plus tard le 19/09 par mail à karen.sauvagnat@irit.fr et gilles.hubert@irit.fr
IDH 2ème partie Roland Barriot

Page dédiée → M2BBS GDNS-APG


Atelier Phylogénomique

Intervenants : Claire Hoede et Yves Quentin

Atelier de Phylogénomique


Biologie des Systèmes - G. Czaplicki

Fichiers avec les codes :

Biologie des Systèmes - G. Fichant

Support de cours:


TP :






Master 2 - ADAM (Adaptation, Développement et Amélioration des plantes en présence de Microorganismes)

Biologie Computationnelle

Documents, partie E. Gaulin


Culture

  • Une histoire de tout ou presque... Bill Bryson, Payot, coll. "Petite Bibliothèque Payot" n° 851, 2012 (ISBN: 9782228907576)
  • Norman Baillargeon - Petit cours d'autodéfense intellectuelle, Éditions Lux, collection Instinct de Liberté, 2005. (ISBN: 2-895960-44-5)
  • Faire l'économie de la haine, Alain Deneault, 2018, Ecosociete Eds, coll. Polemos
  • Comment tout peut s'effondrer. Petit manuel de collapsologie à l'usage des générations présentes. 2015. Pablo Servigne, :Raphaël Stevens. seuil
  • Les sentiers de l'utopie, I. Fremeaux et J. Jordan, 2012.

F.A.Q.

  • Installation de igraph sur CentOS 6.7 en P0

Sous R, l'installation d'igraph échoue avec le protocole https, il faut donc choisir un mirroir avec le protocol http : choseCRANmirror() dernier choix (http mirrors) puis Lyon2

R> chooseCRANmirror()
R> install.packages('igraph')


  • Installation de Rstudio sur CentOS 6.7 en P0

La dernière version de Rstudio desktop ne fonctionne pas pour CentOS6.7 (nécessite des librairies plus récentes). Il faut donc télécharger et installer la version serveur :

# Dans un terminal, passer root (super-utilisateur)
bash> su
# puis les commandes ci-dessous (sans le "root>")
root> wget https://download2.rstudio.org/rstudio-server-rhel-0.99.892-x86_64.rpm
root> yum install --nogpgcheck rstudio-server-rhel-0.99.892-x86_64.rpm

Ensuite, on accède à l'interface avec le navigateur : http://localhost:8787 avec un compte de la machine (normalement le compte guest)