silico.biotoul.fr
 

Enseignements

From silico.biotoul.fr

(Difference between revisions)
Jump to: navigation, search
(Contrôles terminaux en distanciel 2020)
 
(380 intermediate revisions not shown)
Line 1: Line 1:
 +
= Contrôles terminaux en distanciel 2020 =
 +
 +
'''Bioinformatique pour la génomique M1 Bioinfo CT session 2 2 juillet 10h-12h30''' : [[Media:CT_session2_BG_M1Bioinfo_juillet_2020.docx|sujet CT Biooinformatique pour la Génomique]]
 +
= Licence 2 et 3 Biologie  =
= Licence 2 et 3 Biologie  =
-
=== Bioinformatique - 2B2M (EDSVB4IM), BCP (EDSVA4HM), BOPE (L2 EDSVC4MM, L3 ELSVC6JM) ===
+
=== Bioinformatique - Option L2-L3 2B2M-BCP-BOPE ===
-
===='''Emploi du temps 2016-17'''====
+
UE en option avec différents codes :
 +
* L2 2B2M : EDSVB4IM
 +
* L2 BCP : EDSVA4HM
 +
* L2 BOPE : EDSVC4MM
 +
* L3 BOPE : ELSVC6JM
 +
 
 +
* Moodle : [https://moodle.univ-tlse3.fr/course/view.php?id=2518 EDSVB4IM]
 +
 
 +
===='''Emploi du temps 2019-20'''====
Aussi disponible sur https://calendar.google.com/calendar/embed?src=lic.bioinfo%40gmail.com&ctz=Europe/Paris
Aussi disponible sur https://calendar.google.com/calendar/embed?src=lic.bioinfo%40gmail.com&ctz=Europe/Paris
 +
 +
<html>
 +
<iframe src="https://calendar.google.com/calendar/embed?showTitle=0&amp;showCalendars=0&amp;mode=AGENDA&amp;height=400&amp;wkst=2&amp;hl=fr&amp;bgcolor=%23FFFFFF&amp;src=lic.bioinfo%40gmail.com&amp;color=%232952A3&amp;ctz=Europe%2FParis" style="border-width:0" width="550" height="400" frameborder="0" scrolling="no"></iframe>
 +
</html>
 +
 +
 +
 +
<big><big>'''Les groupes de TD et TP 2019-20 sont disponibles sur moodle : [https://moodle.univ-tlse3.fr/course/view.php?id=2518 https://moodle.univ-tlse3.fr/course/view.php?id=2518]'''</big></big>
 +
{| class="wikitable"
{| class="wikitable"
-
!colspan="4"|EDT L2 AADB
+
!colspan="4"|EDT L2-L3 2B2M-BCP-BOPE Bioinformatique
|-
|-
-
|                      || CM                                         || TD        ||  TP
+
|                      || CM 3TP2-Einstein                                    || TD        ||  TP
|-
|-
-
| semaine 04 - 23.01  || 13h30-15h30 U2-Vandel RB Bioinfo générale ||
+
| semaine 04 - 20/01  || 13h30-15h40 R. Barriot  Bioinfo générale           ||
|-
|-
-
| semaine 05 - 30.01  || 13h30-15h30 U1-Mathis FD Imagerie         ||          || 15h45-17h45 <br/> groupes 1 & 2 en 4TP2-M6 et M7 <br/> groupes 3 & 4 en U2-209
+
| semaine 05 - 27/01  || 13h30-15h40 F. Delavoie Imagerie                   ||          || 15h50-18h00 groupes gTP1 en 4TP4-P1 & gTP2 en 4TP4-P15 <br/> 18h10-20h20 groupe gTP3 en 4TP2-M6
|-
|-
-
| semaine 06 - 06.02  || 13h30-15h30 U1-Mathis RB BdD              || 15h45-17h45<br/> groupes 1 & 2 en U2-119<br/> groupes 3 & 4 en Algeco 03 ||
+
| semaine 06 - 03/02  || 13h30-15h40 R. Barriot  Bases de Données            || 15h50-18h00 U2-116 groupe gTD1<br/>18h10-20h20 U2-116 groupe gTD2 ||
|-
|-
-
| semaine 08 - 20.02  ||                                           ||          || 13h30-15h30 groupes 1 & 2 en 4TP2-M6 4TP2-M7 <br/> 15h45-17h45 groupes 3 & 4 en 4TP2-M6 4TP2-M7
+
| semaine 07 - 10/02  ||                                                     ||          || 13h30-15h40 groupe gTP1 en 4TP2-M7 <br/> 15h50-18h00 groupe gTP2 en 4TP4-P15 <br/> 18h10-20h20 groupe gTP3 en 4TP2-M6
|-
|-
-
| semaine 09 - 27.02  || 13h30-15h30 U1-Mathis MB                  ||          || 15h45-17h45 <br/> groupes 1 & 2 en 4TP2-M6 4TP2-M7 <br/> groupe 3 : 4TP4-P1 <br/>  groupe 4 : 4TP4-P15
+
| semaine 08 - 17/02  ||                                                     ||          ||  
|-
|-
-
| semaine 10 - 06.03  || '''13h30-15h30 Contrôle continu en U4-Turing'''             ||          ||
+
| semaine 09 - 24/02  || 13h30-15h40 M. Bonhomme                            ||          || 15h50-18h00 groupes gTP1 en 4TP4-P1 & gTP2 en 4TP4-P15 <br/> 18h10-20h20 groupe gTP3 en 4TP2-M6
 +
|-
 +
| semaine 10 - 02/03  || '''13h30-15h30 Contrôle continu en 4A-Leclerc'''                                           ||          ||  
 +
|- 
 +
| semaine 11 - 09/03  || 13h30-15h40 G. Fichant SysBio                      ||          || 15h50-18h00 groupes gTP1 en 4TP4-P1 & gTP2 en 4TP4-P15 <br/> 18h10-20h20 groupe gTP3 en 4TP2-M6
|-
|-
-
| semaine 11 - 13.03  || U2-Vandel GF/RB                            ||           || 15h45-17h45 <br/> groupes 1 & 2 en 4TP2-M6 4TP2-M7 <br/> groupe 3 : 4TP4-P1 <br/>  groupe 4 : 4TP4-P15
+
| semaine 12 - 16/03  ||                                           || 13h30-15h40 gTD1 en U2-220 <br/> 15h50-18h00 gTD2 en U2-219 ||
|-
|-
-
| semaine 12 - 20.03  ||                                            || 13h30-15h30 groupes 3 & 4 en U2-118 <br/> 15h45-17h45 groupes 1 & 2 en U2-119 ||
+
| semaine 13 - 23/03  ||                                            ||          || 13h30-15h40 groupe gTP1 en 4TP2-M7 <br/> 15h50-18h00 groupe gTP2 en 4TP4-P15 <br/> 18h10-20h20 groupe gTP3 en 4TP2-M6
|-
|-
-
| semaine 13 - 27.03  ||                                            ||          || '''<span style='color: #F00'>13h Consultation des copies en 4TP2-M6</span>''' <br/>13h30-15h30 groupes 1 & 2 en 4TP2-M6 4TP2-M7 <br/> 15h45-17h45 groupes 3 & 4 en 4TP2-M6 4TP2-M7
+
| semaine 14 - 30/03  || '''13h30-15h30 Contrôle terminal anticipé en Eintein''' ||          ||  
-
|-
+
-
| semaine 14 - 03.04   || '''13h30-15h30 Amphi Molliard - Contrôle terminal anticipé'''   ||          ||  
+
|}
|}
-
'''Groupes de TP'''
+
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
<!--
 +
|-
 +
| semaine 20 - 15.05  ||                                            ||          || '''<span style='color: #F00'>12h-13h Consultation des copies en 4TP4-P15</span>'''
 +
 
 +
'''Groupes de TD'''
{| style="border-collapse: separate; border-spacing: 0; border-width: 1px; border-style: solid; border-color: #aabbcc; padding: 3px; width: 100%; background-color: #bbccdd; text-align: center;"
{| style="border-collapse: separate; border-spacing: 0; border-width: 1px; border-style: solid; border-color: #aabbcc; padding: 3px; width: 100%; background-color: #bbccdd; text-align: center;"
-
!colspan="5"|Groupes de TP
+
!colspan="3"|Groupes de TD
|- style="background-color: #ddeeff;"
|- style="background-color: #ddeeff;"
| style="padding-left: 0.5em; border-width: 1px; border-style: solid;" | Groupe 1  
| style="padding-left: 0.5em; border-width: 1px; border-style: solid;" | Groupe 1  
| style="padding-left: 0.5em; border-width: 1px; border-style: solid;" | Groupe 2  
| style="padding-left: 0.5em; border-width: 1px; border-style: solid;" | Groupe 2  
-
| style="padding-left: 0.5em; border-width: 1px; border-style: solid;" | Groupe 3
 
-
| style="padding-left: 0.5em; border-width: 1px; border-style: solid;" | Groupe 4
 
|- style="background-color: #ddeeff;"
|- style="background-color: #ddeeff;"
| style="padding-left: 0.5em; border-width: 1px; border-style: solid;" |  
| style="padding-left: 0.5em; border-width: 1px; border-style: solid;" |  
-
AVERSO JULIEN <br/>
 
-
BERLIN TRISTAN <br/>
 
-
BOULLIAT VINCENT <br/>
 
-
CERRUTI CLOE <br/>
 
-
COLIN ALEXANDRE <br/>
 
-
DAUPHIN BASTIEN <br/>
 
-
DELERIS KILIAN <br/>
 
-
FERNANDEZ MAXIMILIEN <br/>
 
-
FOURCAUD GUSTAVE <br/>
 
-
JMEL BOYER INES <br/>
 
-
LEBRUN TANGUY <br/>
 
-
LEFEVRE PAUL <br/>
 
-
RALAHY MAEVA <br/>
 
-
STUTZ MANON <br/>
 
-
TRUFFET ARTHUR <br/>
 
-
 
-
| style="padding-left: 0.5em; border-width: 1px; border-style: solid;" |
 
-
BENHAMA LYDIA <br/>
 
-
BISSANE YOUSSEF <br/>
 
-
BOUILLAUD CLEMENTINE <br/>
 
-
CLEDASSOU VALENTIN <br/>
 
-
COPPEAUX ELOISE <br/>
 
-
DUPUYAU ROSELINE <br/>
 
-
FERHAH MANEL <br/>
 
-
FOURCADE MARIE <br/>
 
-
GAYET CEDRIC <br/>
 
-
HMILA IMEN <br/>
 
-
HOORELBECK - BROUQUI MARGAUX <br/>
 
-
MIRANDA-CAPET ROMAIN <br/>
 
-
NGUYEN HAI LINH <br/>
 
-
TARAYRE GABRIEL <br/>
 
-
VELPRAT LOIC <br/>
 
 +
L2 BCP<br/>
 +
et<br/>
 +
L2 2B2M (Nom de famille commençant par : A jusqu'à G inclus)
| style="padding-left: 0.5em; border-width: 1px; border-style: solid;" |  
| style="padding-left: 0.5em; border-width: 1px; border-style: solid;" |  
-
AMO TEIHOARII <br/>
 
-
BONOTTO ELISE <br/>
 
-
CANUT BENJAMIN <br/>
 
-
COOKE JULIETTE <br/>
 
-
COSSOU MATTHIAS <br/>
 
-
DASSIEU CECILE <br/>
 
-
DURAND GAETAN <br/>
 
-
KHALED MERIEM <br/>
 
-
KHELIFI FATMA <br/>
 
-
LACOSTE Pierre <br/>
 
-
LAJAT AMANDINE <br/>
 
-
LANDURE BRICE <br/>
 
-
LORVELLEC MARIE <br/>
 
-
PERRIER MARION <br/>
 
-
SUIRE PAUL <br/>
 
-
 
+
L2/L3 BOPE<br/>
-
| style="padding-left: 0.5em; border-width: 1px; border-style: solid;" |
+
et
-
ALBERT HEVIA FABIO <br/>
+
<br/>
-
BERNES - LASSERRE PASCALE <br/>
+
L2 2B2M (Nom de famille commençant par : K à Z)
-
CHATELAIS MYLENE <br/>
+
-
DESCOMBE THOMAS <br/>
+
-
FLANER PRISCILLA <br/>
+
-
FOUGERON BAPTISTE <br/>
+
-
GENAIS MATTHIEU <br/>
+
-
INVERNIZZI MARIE <br/>
+
-
MAMODE ANTHONY <br/>
+
-
MARCHARD LAURA <br/>
+
-
PIPPO QUENTIN <br/>
+
-
RANTY SARAH <br/>
+
-
TEULIER MARIELLE <br/>
+
-
VAILLE MELANIE <br/>
+
-
VERA LEANDRO <br/>
+
|}
|}
 +
-->
===='''Supports de cours'''====
===='''Supports de cours'''====
Line 119: Line 94:
* CM3 [[Media:LBioinfo.systemes.d.information.pdf|Introduction aux bases de données]]
* CM3 [[Media:LBioinfo.systemes.d.information.pdf|Introduction aux bases de données]]
* CM4 [[Media:LBioinfo_Genetics_bis.pdf|Utilisation de l'information génétique en biologie]]
* CM4 [[Media:LBioinfo_Genetics_bis.pdf|Utilisation de l'information génétique en biologie]]
-
* CM5 [[Media:Intro_BioSyst_L2.pdf|Introduction à la biologie des système : initiation à la modélisation de réseaux de gènes]]
+
* CM5 [[Media:Intro_BioSyst_L2_2019.pdf|Introduction à la biologie des système : initiation à la modélisation de réseaux de gènes]]
===='''Sujets de TD/TP'''====
===='''Sujets de TD/TP'''====
Line 129: Line 104:
* [[Media:L2-L3 Bioinfo - TD Transcriptomique.pdf|TD2]] Transcriptomique
* [[Media:L2-L3 Bioinfo - TD Transcriptomique.pdf|TD2]] Transcriptomique
* [[Media:TP_modelisation_regulation_fls2.pdf|TP5 Modélisation d'un réseau de régulation]]
* [[Media:TP_modelisation_regulation_fls2.pdf|TP5 Modélisation d'un réseau de régulation]]
-
* [[Media:TP_regulation_fls2.pdf|correction du TP5 Modélisation d'un réseau de régulation]]
+
** [[Media:snoopy.7z|archive installation de snoopy]]  
-
 
+
** [[Media:fls2_regulation_simplifie.spn|réseau de Petri stochastique pour la régulation de fls2]]
-
* [[Media:snoopy.7z|archive installation de snoopy]]
+
** [[Media:TP_regulation_fls2.pdf|correction du TP5 Modélisation d'un réseau de régulation]]
-
<!-- * [[Media:fls2_regulation_simplifie.spn|réseau de Petri stochastique pour la régulation de fls2]] -->
+
=== BioAnalyse L3 BCP ===
=== BioAnalyse L3 BCP ===
-
===='''Planning des Enseignements L3 BCP semestre 6 (ELSV6CM1)'''====
+
==='''Planning des Enseignements L3 BCP semestre 6 (ELSV6CM1)'''===
-
* [[Media:1617Planning Bionalyse L3 BCP.pdf|Planning L3 BCP 2016_2017]]
+
* [[Media:1920_Bioanalyse_planning.pdf|Planning Bioanalyse L3 BCP 2019_2020]]
 +
* [[Media:presentation_UE_bioanalyse_2020.pdf|Présentation de l'UE]]
 +
<!--
 +
* [[Media:1819_Planning TPS CMs.pdf|Planning Bioanalyse L3 BCP 2018_2019]]
 +
* [[Media:presentation_UE_bioanalyse_2019.pdf|Présentation de l'UE]]
 +
 
 +
-->
===='''Cours'''====
===='''Cours'''====
-
* CM1 : [[Media:Introduction_bioinfo_2017.pdf|Introduction à la bioinformatique]]
+
* CM1 : [[Media:Introduction_bioinfo_2020_modified.pdf|Introduction à la bioinformatique]]
-
* CM2 : [[Media:banque_2017.pdf|Introduction aux banques de données]]
+
* CM2 : [[Media:banque_2020.pdf|Introduction aux banques de données]]
* CM3 : [[Media:Alignement_seq_nuc.pdf|Alignement de deux séquences d'acides nucléiques]]
* CM3 : [[Media:Alignement_seq_nuc.pdf|Alignement de deux séquences d'acides nucléiques]]
* CM4 : [[Media:Alignement_seq_prot_2015.pdf|Alignement de deux séquences protéiques : les matrices de substitution]]
* CM4 : [[Media:Alignement_seq_prot_2015.pdf|Alignement de deux séquences protéiques : les matrices de substitution]]
-
* CM5 : [[Media:Blast_2016.pdf|Recherche par similarité dans les bases de données]]
+
* CM5 : [[Media:Blast_2020.pdf|Recherche par similarité dans les bases de données]]
* CM6 : [[Media:AlignementMultiple_2017.pdf|Alignement multiple]]
* CM6 : [[Media:AlignementMultiple_2017.pdf|Alignement multiple]]
* CM6 : [[Media:motif_profil_2017.pdf|Motif et domaine fonctionnels]]
* CM6 : [[Media:motif_profil_2017.pdf|Motif et domaine fonctionnels]]
Line 157: Line 137:
* TP5 : [[TD5_Bioanalyse|Revisions]]
* TP5 : [[TD5_Bioanalyse|Revisions]]
-
===='''Exemples de contrôle continue corrigé'''====
+
===='''Exemples de contrôle continu corrigé'''====
* CC 2014 : [[Media:Correction_sujet_CC_L3Biologie_EL6BIOFM_2014.pdf|Questions + corrections]]
* CC 2014 : [[Media:Correction_sujet_CC_L3Biologie_EL6BIOFM_2014.pdf|Questions + corrections]]
* CC 2014 : [[Media:correction_alignement_CC_2013.pdf|correction de la construction de la matrice de programmation dynamique]]
* CC 2014 : [[Media:correction_alignement_CC_2013.pdf|correction de la construction de la matrice de programmation dynamique]]
-
* CC 2013 : [[Media:Correction_sujet_CC_L3Biologie_EL6BIOFM.pdf|Questions + corrections]]
+
<!-- * CC 2013 : [[Media:Correction_sujet_CC_L3Biologie_EL6BIOFM.pdf|Questions + corrections]]
-
* CC 2017 : [[Media:sujet_CC_Bioanalyse_L3BCP_2017_correction.pdf|Correction du contrôle continu 2017]]
+
* CC 2017 : [[Media:sujet_CC_Bioanalyse_L3BCP_2017_correction.pdf|Correction du contrôle continu 2017]] -->
 +
 
 +
=== BioAnalyse L3 2B2M ===
 +
 
 +
===='''TPs'''====
 +
 
 +
* TP1 : [[TD1_Bioanalyse|Interrogation des banques de données]]
 +
* TP2 : [[TD2_Bioanalyse|Alignement par paires]]
 +
* TP3 : [[Bioanalyse_TD_Analyse_de_sequences_et_Biologie_Moleculaire|Analyse de séquences et biologie Moléculaire]]
 +
* TP4 : [[TD4_Bioanalyse|BLAST, alignement multiple, signature protéique]]
 +
* TP5 : [[TD5_Bioanalyse|Revisions]]
= Licence 3 Biologie des Organismes des populations et Ecosystemes (BOPE)  =
= Licence 3 Biologie des Organismes des populations et Ecosystemes (BOPE)  =
=== Du génome à la sélection des plantes (ELSVC5EM) ===
=== Du génome à la sélection des plantes (ELSVC5EM) ===
-
* TP : [[TP Initiation Bioanalyse |Initiation Bioanalyse]]
 
<!--
<!--
 +
TP pour une seance unique de 4h
 +
* TP : [[TP Initiation Bioanalyse |Initiation Bioanalyse]]
 +
-->
 +
Initiation à la 'Bioanalyse'
 +
* TP1 : [[TD1_Genome Selection Plantes|Interrogation des banques de données et recherche par similarité]]
* TP1 : [[TD1_Genome Selection Plantes|Interrogation des banques de données et recherche par similarité]]
 +
<!--
* TP2 : [[TD2_Genome Selection Plantes|Alignement multiples et signatures proteiques]]
* TP2 : [[TD2_Genome Selection Plantes|Alignement multiples et signatures proteiques]]
 +
==== Harmonisation des Connaissances, partie Bioanalyse (EMBIA1IM) ====
 +
* Supports de cours
 +
http://www.mabs.ups-tlse.fr/index.php/Ressources_pedagogique#Bioanalyse_.28EM7BMGD2.29
 +
* TD1 : [[Interrogation des banques de données]]
 +
* TD2 : [[Analyse de séquences I: recherche par similarité, alignements deux à deux]]
 +
* TD3 : [[Analyse de séquences II: alignements multiples et profils]]|
 +
-->
 +
<!--
== Licence 3 ==
== Licence 3 ==
Line 251: Line 254:
'''Supports de cours :'''
'''Supports de cours :'''
-
* [[Media:M1 Traitement de Donnees Biologiques - Statistiques et Analyses Multivariees.pdf|Statistiques et Analyses Multivariées - M. Bonhomme]]
+
* [[Media:M1 Traitement de Donnees Biologiques - Statistiques et Analyses Multivariees.pdf|Statistiques - M. Bonhomme]]
* [[Media:Transcriptome.pdf|Transcriptome - R. Barriot]]
* [[Media:Transcriptome.pdf|Transcriptome - R. Barriot]]
Line 271: Line 274:
-->
-->
 +
<!--
 +
 +
 +
 +
<big>'''Contrôle continu'''</big>
 +
* Contrôle continu 2019-20 : [[silico:enseignement/m1/tdb/CC2019/|Sujet et fichiers à utiliser]]
 +
 +
 +
<big>'''Contrôle continu'''</big>
 +
* Contrôle continu 2018-19 : [[silico:enseignement/m1/tdb/CC2018/|Sujet et fichiers à utiliser]]
 +
 +
<big>'''Contrôle continu'''</big>
 +
* Contrôle continu 2017-18 : [[silico:enseignement/m1/tdb/CC2017/|Sujet et fichiers à utiliser]]
 +
-->
 +
 +
<!--
'''Contrôle continu'''
'''Contrôle continu'''
* Contrôle continu 2016 : [[silico:enseignement/m1/tdb/cc2016.html|Sujet et fichiers à utiliser]]
* Contrôle continu 2016 : [[silico:enseignement/m1/tdb/cc2016.html|Sujet et fichiers à utiliser]]
 +
-->
 +
* Archives
* Archives
** Contrôle continu de 2011 avec son corrigé [[Media:M1 MABS Traitement de Donnees Biologiques - CC 2011 et correction.zip|CC 2011 et correction.zip]]
** Contrôle continu de 2011 avec son corrigé [[Media:M1 MABS Traitement de Donnees Biologiques - CC 2011 et correction.zip|CC 2011 et correction.zip]]
Line 286: Line 307:
** RStudio : https://www.rstudio.com
** RStudio : https://www.rstudio.com
** https://www.datacamp.com Apprendre R en ligne
** https://www.datacamp.com Apprendre R en ligne
 +
** https://rdrr.io/snippets/ Utilisation de R depuis un navigateur
 +
<!-- deprecated
** http://tryr.codeschool.com/levels/1/challenges/1 Apprendre en ligne aussi
** http://tryr.codeschool.com/levels/1/challenges/1 Apprendre en ligne aussi
** http://www.r-fiddle.org Utilisation de R depuis un navigateur
** http://www.r-fiddle.org Utilisation de R depuis un navigateur
 +
-->
==== Génétique Evolutive et Quantitative (EMBIA1GM) ====
==== Génétique Evolutive et Quantitative (EMBIA1GM) ====
'''Support de cours:'''
'''Support de cours:'''
-
* [[Media: GEQ_presentation.pdf|présentation de GEQ - M. Bonhomme]]
+
* [[Media: GEQ_presentation1.pdf|présentation de GEQ - M. Bonhomme]]
* [[Media: GEQ_intro.pdf|introduction à GEQ - M. Bonhomme]]
* [[Media: GEQ_intro.pdf|introduction à GEQ - M. Bonhomme]]
-
* [[Media: GEQ_pop_gen.pdf|GE - Génétique des populations - M. Bonhomme]]
+
* [[Media: GEQ_pgen.pdf|GE - Génétique des populations - M. Bonhomme]]
-
* [[Media: Genetique-quantitative.pdf|GQ - Génétique-quantitative - C. Robert-Granié]]
+
* [[Media: CM_Genetique_Quantitative_2019.pdf|GQ - Génétique-Quantitative - M. Bonhomme]]
-
* [[Media: Genetique-quantitative-Parente.pdf|GQ - Génétique-quantitative-apparentement - C. Robert-Granié]]
+
* [[Media: Carto_Génétique_2019.pdf|GQ - Cartographie génétique - M. Bonhomme]]
-
* [[Media: Carto_Marqueurs.pdf|GQ - Cartographie de marqueurs moléculaires - B. Mangin]]
+
-
* [[Media: Carto_QTL.pdf|GQ - Cartographie de Quantitative Tait Loci - B. Mangin]]
+
-
* [[Media: Asso-QTL.pdf|GQ - Génétique d'association - B. Mangin]]
+
'''Supports de TD/TP :'''
'''Supports de TD/TP :'''
-
* [[Media: TD1_GEQ_pop_gen.pdf|TD1 génétique des populations]]
+
* [[Media: TD1_GEQ_pgen.pdf|TD1 génétique des populations]]
* [[Media: TP1_genetic_diversity_drift.zip|TP1 génétique des populations]]
* [[Media: TP1_genetic_diversity_drift.zip|TP1 génétique des populations]]
-
* [[Media: TD-Génétique Statistique-2016.pdf|TD2 génétique quantitative liaison/association]]
+
* [[Media: TD-Génétique_Quantitative_2019.pdf|TD2 génétique quantitative]]
-
* [[Media: TP2-parente-moleculaire.zip|TP2 génétique quantitative parenté moléculaire]]
+
* [[Media: TP_heritability.zip|TP2 génétique quantitative]]
-
* [[Media: TD-backcross.pdf|TD3 génétique quantitative liaison/association]]
+
* [[Media: TD3_carto_génétique_2019.pdf|TD3 cartographie génétique]]
-
* [[Media: TP2-measureLD.zip|TP3 génétique quantitative mesures DL]]
+
=== Master 1 - Bioinformatique et Biologie des Systèmes + Biotechnologies ===
=== Master 1 - Bioinformatique et Biologie des Systèmes + Biotechnologies ===
Line 313: Line 333:
'''Supports de cours :'''
'''Supports de cours :'''
* [[Media:CM1_EM_intro.pdf|Introduction à l'évolution moléculaire]]
* [[Media:CM1_EM_intro.pdf|Introduction à l'évolution moléculaire]]
-
* [[Media:Phylogenie_Definitions_2015.pdf|Evolution moléculaire : définitions]]
+
* [[Media:Phylogenie_Definitions_2019.pdf|Evolution moléculaire : définitions]]
-
* [[Media:Phylogenie_Modeles_Evolutifs_2015.pdf|Modèles évolutifs]]
+
* [[Media:Phylogenie_Modeles_Evolutifs_2019.pdf|Modèles évolutifs]]
-
* [[Media:Phylogenie_Methodes_2014.pdf|Méthodes de reconstructions phylogénétiques ]]
+
* [[Media:Phylogenie_Methodes_2019.pdf|Méthodes de reconstructions phylogénétiques ]]
* [[Media:Phylogenie_Methodes_part2_2014.pdf|Méthodes de reconstructions phylogénétiques (suite)]]
* [[Media:Phylogenie_Methodes_part2_2014.pdf|Méthodes de reconstructions phylogénétiques (suite)]]
-
* [[Media:CM6_EM_adapt_mol1.pdf|Adaptation moléculaire]]
+
* [[Media:cours_EM_adapt_mol.pdf|Adaptation moléculaire]]
'''Support TP : '''
'''Support TP : '''
* [[silico:enseignement/m1-mabs/EvolMol/TD1/index.html|tutorial TP1 et TP2]]
* [[silico:enseignement/m1-mabs/EvolMol/TD1/index.html|tutorial TP1 et TP2]]
-
* [[Media:Introduction_competence_2017.pdf|Petit topo d'introduction sur la régulation de la compétence chez ''S. pneumoniae'']]
+
* [[Media:Introduction_competence_2020.pdf|Petit topo d'introduction sur la régulation de la compétence chez ''S. pneumoniae'']]
-
* [[Media:Correction_TP1_TP2_2017_new.pdf|Correction des TP1 et TP2]]
+
* [[Media:Correction_TP1_TP2_2018.pdf|Correction des TP1 et TP2]]  
-
* [[Media:questions_reponses_ComD_ComE_trees.pdf|Correction du questionnaire sur l'analyse des arbres ComE et COmD]]
+
* [[Media:questions_reponses_ComD_ComE_trees_srep_2019.pdf|Questionnaire sur l'analyse des arbres ComE et ComD]]
 +
* [[Media:questions_reponses_ComD_ComE_trees_2020.pdf|Correction du questionnaire sur l'analyse des arbres ComE et ComD]]  
* [[Media:TP3_adaptation_moleculaire.zip|tutorial TP3]]
* [[Media:TP3_adaptation_moleculaire.zip|tutorial TP3]]
 +
* [[Media:TP3_adaptation_moleculaire_2019_2020.zip|tutorial TP3_2019_2020]]
'''Support TD : '''
'''Support TD : '''
Line 331: Line 353:
* [[Media:TD1_Evolution_Moleculaire.pdf|TD1 ]]
* [[Media:TD1_Evolution_Moleculaire.pdf|TD1 ]]
* [[Media:TD2_EMBAIE_M1_Bioinfo_M1_Biotech.pdf|TD2 exemple de Contrôle continu ]]
* [[Media:TD2_EMBAIE_M1_Bioinfo_M1_Biotech.pdf|TD2 exemple de Contrôle continu ]]
-
* [[Media:Correction_TD2_Evolution_Moleculaire.pdf|Correction du TD2 ]]
+
* [[Media:Correction_TD2_Evolution_Moleculaire_2020.pdf|Correction du TD2 ]]
* [[Media:TD3 Evolution Moléculaire.pdf|TD3 Adaptation moléculaire ]]
* [[Media:TD3 Evolution Moléculaire.pdf|TD3 Adaptation moléculaire ]]
Line 357: Line 379:
==== Bioinformatique pour la Génomique (EMBIA1DM) ====
==== Bioinformatique pour la Génomique (EMBIA1DM) ====
'''Supports de cours :'''
'''Supports de cours :'''
-
* [[Media:Introduction_bio_annotation.pdf|Introduction biologique  (Gwennaele Fichant)]]
+
* [[Media:Introduction_bio_annotation_2018.pdf|Introduction biologique  (Gwennaele Fichant)]]
* [[Media:Annotation1.pdf|Annotation partie 1 (Gwennaele Fichant)]]
* [[Media:Annotation1.pdf|Annotation partie 1 (Gwennaele Fichant)]]
-
* [[Media:Annotation2_v2_2016.pdf|Annotation partie 2 (Gwennaele Fichant)]]
+
* [[Media:annotation2_2019.pdf|Annotation partie 2 (Gwennaele Fichant)]]
-
* [[Media:motif_profil_2014.pdf|Définition et identification des motifs et profils dans les séquences (cours de L3 Bioanalyse) (Gwennaele Fichant)]]
+
* [[Media:motif_profil_2017.pdf|Définition et identification des motifs et profils dans les séquences (cours de L3 Bioanalyse) (Gwennaele Fichant)]]
-
* [[Media:HMM_2015.pdf|Modèle de Markov Caché (HMM) (Gwennaele Fichant)]]
+
* [[Media:HMM_2017.pdf|Modèle de Markov Caché (HMM) (Gwennaele Fichant)]]  
* [[Media:cours-align_genome.pdf|Introduction aux alignements de génomes bactériens (Gwennaele Fichant)]]
* [[Media:cours-align_genome.pdf|Introduction aux alignements de génomes bactériens (Gwennaele Fichant)]]
'''Tutoriels de TP :'''
'''Tutoriels de TP :'''
-
*[[silico:enseignement/m1-bioinfo/BG/TD_annotation/tutorial_annotation_new_NVU.html|Annotation d'un fragment génomique bactérien]]
+
*[[silico:enseignement/m1-bioinfo/BG/TD_annotation/Tutorial_annotation_v1_2019.html|Annotation d'un fragment génomique bactérien]]
-
*[[silico:enseignement/m1-bioinfo/BG/summary_SignalP.pdf|Petite explication de SignalP]]
+
<!--*[[silico:enseignement/m1-bioinfo/BG/summary_SignalP.pdf|Petite explication de SignalP]] -->
-
*[[silico:enseignement/m1-bioinfo/BG/TD_HMM/TD_HMM.html| design d'un HMM pour prédire les promoteurs sigma A de B. subtilis]]
+
*[[silico:enseignement/m1-bioinfo/BG/TD_HMM/TD_HMM_2017.html| design d'un HMM pour prédire les promoteurs sigma A de B. subtilis]]
-
*[[Media:Complement_TD_HMM.pdf|Complément d'information pour réaliser le TD de design du HMM ]]
+
**[[Media:SHOW.tar.gz|archive compressée de SHOW à télécharger]]
 +
**[[silico:enseignement/m1-bioinfo/BG/TD_HMM/seq.tar.gz|archive des séquences compressée]]
 +
<!-- *to download: [[silico:enseignement/m1-bioinfo/BG/TD_HMM/show_saba.tar.gz| show_saba.tar.gz]] -->
 +
<!--*[[Media:Complement_TD_HMM.pdf|Complément d'information pour réaliser le TD de design du HMM ]]-->
-
Aide pour la réalistion du projet annotation
+
Aide pour la réalisation du projet annotation
*[[silico:enseignement/m1-bioinfo/BG/TD_artemis/Annotation_artemis.html|Introduction à Artemis]]
*[[silico:enseignement/m1-bioinfo/BG/TD_artemis/Annotation_artemis.html|Introduction à Artemis]]
*[[silico:enseignement/m1-bioinfo/BG/memo_Perl.html|Petit guide de programmation en Perl]]
*[[silico:enseignement/m1-bioinfo/BG/memo_Perl.html|Petit guide de programmation en Perl]]
Line 376: Line 401:
'''Contrôle continu :'''  
'''Contrôle continu :'''  
-
* '''Rapport de TP''' sur le design d'un HMM à rendre au plus tard le '''lundi 14 novembre'''. M'envoyer pa courrier le rapport en format pdf ainsi que le fichier en format texte comportant votre modèle avant estimation des probabilités.
+
*'''Rapport de TP''' sur le design d'un HMM à rendre au plus tard le '''lundi 14 octobre'''. M'envoyer par courrier le rapport en format pdf ainsi que le fichier en format texte comportant votre modèle avant estimation des probabilités.
-
* '''Projet annotation''' d'un fragment génomique à remettre au plus tard '''le vendredi 9 décembre'''  
+
* '''Projet annotation''' d'un fragment génomique à remettre au plus tard '''le lundi 9 décembre'''  
-
** '''Description du travail à réaliser dans le fichier ci-joint : [[Media:Projet_2016.docx|description du projet]]
+
** '''Description du travail à réaliser dans le fichier ci-joint''' : [[Media:Projet_2019.docx|description du projet]]
 +
** '''Description du travail à réaliser pour les parsers dans le fichier ci-joint''' : [[Media:Description_parsers_2019.docx|description des parsers]]
** '''Annoter une des deux séquences fournies''' : [[Media:seq1-5404.txt|séquence 1]] ou [[Media:seq2-7490.txt|séquence 2]]
** '''Annoter une des deux séquences fournies''' : [[Media:seq1-5404.txt|séquence 1]] ou [[Media:seq2-7490.txt|séquence 2]]
** [[Media:exemple_annotation_EMBL.txt|Exemple d'annotation au format EMBL]]
** [[Media:exemple_annotation_EMBL.txt|Exemple d'annotation au format EMBL]]
Line 400: Line 426:
==== Mathématique pour la Biologie (EMBIA1EM) ====
==== Mathématique pour la Biologie (EMBIA1EM) ====
-
* [[Media:M1 MABS BBS Math Memento.pdf|Memento]] de Régine André-Obrecht
+
 
 +
'''Sujets de TP :'''
 +
 
* [[M1 MABS BBS Math TD Calcul Matriciel|TD]] Calcul matriciel
* [[M1 MABS BBS Math TD Calcul Matriciel|TD]] Calcul matriciel
* [[M1 BBS Math TD ACP|TD]] ACP
* [[M1 BBS Math TD ACP|TD]] ACP
Line 406: Line 434:
* [[M1 MABS BBS Math TD Proba|TD]] Probabilités
* [[M1 MABS BBS Math TD Proba|TD]] Probabilités
 +
<!--
 +
<big>'''Exam TP'''</big>
 +
* Exam TP 2018-19 : [[silico:enseignement/m1/math/cc/|Sujet et fichiers à utiliser]]
 +
-->
 +
'''Liens :'''
 +
* http://exercism.io : améliorer son niveau de programmation dans différents langages (notamment R)
 +
 +
'''Références'''
 +
* ''Mathématiques pour les Sciences de la vie et de la Terre'' – C. David, S. Mustapha, F. Viens, N. Capron, edition Dunod
 +
 +
'''Projet 2019-20 :'''
 +
* [[silico:enseignement/m1/math/projet/M1BBS_Math_Sujet_Projet_2019-20.html|Sujet du projet 2019-20]]
 +
* Choix d'un graphe pour le projet (ne pas prendre un graphe déjà choisi par quelqu'un d'autre) : https://framadate.org/M1BBS-Projet-Math
 +
* Les projets sont à rendre '''avant''' les fêtes de fin d'année
 +
* Graphe à analyser
 +
*# [[silico:enseignement/m1/math/projet/g1.gr|graphe 1]]
 +
*# [[silico:enseignement/m1/math/projet/g2.gr|graphe 2]]
 +
*# [[silico:enseignement/m1/math/projet/g3.gr|graphe 3]]
 +
*# [[silico:enseignement/m1/math/projet/g4.gr|graphe 4]]
 +
*# [[silico:enseignement/m1/math/projet/g5.gr|graphe 5]]
 +
*# [[silico:enseignement/m1/math/projet/g6.gr|graphe 6]]
 +
*# [[silico:enseignement/m1/math/projet/g7.gr|graphe 7]]
 +
*# [[silico:enseignement/m1/math/projet/g8.gr|graphe 8]]
 +
*# [[silico:enseignement/m1/math/projet/g9.gr|graphe 9]]
 +
*# [[silico:enseignement/m1/math/projet/g10.gr|graphe 10]]
 +
*# [[silico:enseignement/m1/math/projet/g11.gr|graphe 11]]
 +
*# [[silico:enseignement/m1/math/projet/g12.gr|graphe 12]]
 +
*# [[silico:enseignement/m1/math/projet/g13.gr|graphe 13]]
 +
*# [[silico:enseignement/m1/math/projet/g14.gr|graphe 14]]
 +
*# [[silico:enseignement/m1/math/projet/g15.gr|graphe 15]]
 +
*# [[silico:enseignement/m1/math/projet/g16.gr|graphe 16]]
 +
*# [[silico:enseignement/m1/math/projet/g17.gr|graphe 17]]
 +
*# [[silico:enseignement/m1/math/projet/g18.gr|graphe 18]]
 +
*# [[silico:enseignement/m1/math/projet/g19.gr|graphe 19]]
 +
*# [[silico:enseignement/m1/math/projet/g20.gr|graphe 20]]
 +
*# [[silico:enseignement/m1/math/projet/g21.gr|graphe 21]]
 +
*# [[silico:enseignement/m1/math/projet/g22.gr|graphe 22]]
 +
*# [[silico:enseignement/m1/math/projet/g23.gr|graphe 23]]
 +
*# [[silico:enseignement/m1/math/projet/g24.gr|graphe 24]]
 +
 +
<!-- ARCHIVES
 +
 +
 +
'''Projet 2018-19:'''
 +
* [[silico:enseignement/m1/math/projet/M1BBS_Math_Sujet_Projet_2018-19.html|Sujet du projet 2018-19]]
 +
* constitution des groupes (2 personnes par groupe) pour le projet : https://framadate.org/M1BBS-Groupes-Projet-Math
 +
* Les projets sont à rendre '''avant''' les fêtes de fin d'année
 +
* Graphe à analyser pour chaque groupe
 +
*# [[silico:enseignement/m1/math/projet/g1.gr|Groupe 1]]
 +
*# [[silico:enseignement/m1/math/projet/g2.gr|Groupe 2]]
 +
*# [[silico:enseignement/m1/math/projet/g3.gr|Groupe 3]]
 +
*# [[silico:enseignement/m1/math/projet/g4.gr|Groupe 4]]
 +
*# [[silico:enseignement/m1/math/projet/g5.gr|Groupe 5]]
 +
*# [[silico:enseignement/m1/math/projet/g6.gr|Groupe 6]]
 +
*# [[silico:enseignement/m1/math/projet/g7.gr|Groupe 7]]
 +
*# [[silico:enseignement/m1/math/projet/g8.gr|Groupe 8]]
 +
*# [[silico:enseignement/m1/math/projet/g9.gr|Groupe 9]]
 +
*# [[silico:enseignement/m1/math/projet/g10.gr|Groupe 10]]
 +
 +
 +
 +
*# [[silico:enseignement/m1/math/projet/Cleandb_Luca_2_A_1_1_65_Iso_Tr_1-CC1.gr|Groupe 1]]
 +
*# [[silico:enseignement/m1/math/projet/Cleandb_Luca_2_A_1_1_65_Iso_Tr_1-CC2.gr|Groupe 2]]
 +
*# [[silico:enseignement/m1/math/projet/Cleandb_Luca_2_A_1_1_65_Iso_Tr_1-CC3.gr|Groupe 3]]
 +
*# [[silico:enseignement/m1/math/projet/Cleandb_Luca_3_A_1_1_65_Iso_Tr_1-CC1.gr|Groupe 4]]
 +
*# [[silico:enseignement/m1/math/projet/Cleandb_Luca_4_A_1_1_65_Iso_Tr_1-CC1.gr|Groupe 5]]
 +
*# [[silico:enseignement/m1/math/projet/Cleandb_Luca_4_A_1_1_65_Iso_Tr_1-CC2.gr|Groupe 6]]
 +
*# [[silico:enseignement/m1/math/projet/Cleandb_Luca_5_A_1_1_65_Iso_Tr_1-CC1.gr|Groupe 7]]
 +
*# [[silico:enseignement/m1/math/projet/|Groupe 8]]
 +
*# [[silico:enseignement/m1/math/projet/|Groupe 9]]
 +
*# [[silico:enseignement/m1/math/projet/|Groupe 10]]
 +
 +
 +
'''Projet 2017-18:'''
 +
* [[silico:enseignement/m1/math/projet/M1BBS_Math_Sujet_Projet_2017-18.html|Sujet du projet 2017-18]]
 +
* constitution des groupes (2 ou 3 personnes par groupe) pour le projet : https://framadate.org/RlOS3KoUKgmRHM5s
 +
* Les projets sont à rendre '''avant''' le 4 Décembre
 +
* Graphe à analyser pour chaque groupe
 +
*# [[silico:enseignement/m1/math/projet/Cleandb_Luca_2_A_1_1_65_Iso_Tr_1-CC1.gr|Groupe 1]]
 +
*# [[silico:enseignement/m1/math/projet/Cleandb_Luca_2_A_1_1_65_Iso_Tr_1-CC2.gr|Groupe 2]]
 +
*# [[silico:enseignement/m1/math/projet/Cleandb_Luca_2_A_1_1_65_Iso_Tr_1-CC3.gr|Groupe 3]]
 +
*# [[silico:enseignement/m1/math/projet/Cleandb_Luca_3_A_1_1_65_Iso_Tr_1-CC1.gr|Groupe 4]]
 +
*# [[silico:enseignement/m1/math/projet/Cleandb_Luca_4_A_1_1_65_Iso_Tr_1-CC1.gr|Groupe 5]]
 +
*# [[silico:enseignement/m1/math/projet/Cleandb_Luca_4_A_1_1_65_Iso_Tr_1-CC2.gr|Groupe 6]]
 +
*# [[silico:enseignement/m1/math/projet/Cleandb_Luca_5_A_1_1_65_Iso_Tr_1-CC1.gr|Marie G.]]
 +
 +
 +
<big>'''Exam TP'''</big>
 +
* Exam TP 2017-18 : [[silico:enseignement/m1/math/cc/|Sujet et fichiers à utiliser]]
 +
 +
<!--* [[Media:M1 MABS BBS Math Memento.pdf|Memento]] de Régine André-Obrecht-->
 +
 +
<!--
'''Contrôl continu décembre 2016'''
'''Contrôl continu décembre 2016'''
* Sujet au format [[silico:enseignement/m1/math/cc/2016.Math.CC.html|HTML]] et [[silico:enseignement/m1/math/cc/2016.Math.CC.Rmd|Rmd]] et l'image nécessaire pour la compilation au niveau du dernier exercice [[silico:enseignement/m1/math/cc/CC.nfbl.png|CC.nfbl.png]]
* Sujet au format [[silico:enseignement/m1/math/cc/2016.Math.CC.html|HTML]] et [[silico:enseignement/m1/math/cc/2016.Math.CC.Rmd|Rmd]] et l'image nécessaire pour la compilation au niveau du dernier exercice [[silico:enseignement/m1/math/cc/CC.nfbl.png|CC.nfbl.png]]
 +
-->
-
'''Projet 2016-17:'''
 
-
* [[silico:enseignement/m1/math/projet/M1BBS_Math_Sujet_Projet_2016-17.html|Sujet du projet 2016-17]]
 
-
* constitution des groupes (3 personnes par groupe) pour le projet : https://framadate.org/SRCce9gqmq5yfaBM
 
<!-- * [[M1 MABS CC Math 2012-12]] -->
<!-- * [[M1 MABS CC Math 2012-12]] -->
<!--
<!--
Line 423: Line 542:
-->
-->
-
'''Références'''
 
-
* ''Mathématiques pour les Sciences de la vie et de la Terre'' – C. David, S. Mustapha, F. Viens, N. Capron, edition Dunod
 
Line 452: Line 569:
==== Traitement de graphes et réseaux biologiques (EMBIA1KM) ====
==== Traitement de graphes et réseaux biologiques (EMBIA1KM) ====
-
 
-
<!--
 
-
'''Emploi du temps 2015-16'''
 
-
Les CM ont lieu en salle S20, les TP en salle 4TP4-P1.
 
-
{| class="wikitable"
 
-
!colspan="4"|EDT M1 Traitement de graphes et réseaux biologiques
 
-
|-
 
-
|                    || CM mardi 15h45-17h45 en S20    || TP mercredi 13h30-17h30 en 4TP4-P1
 
-
|-
 
-
| semaine 3 - 18.01    || RB CM1 Intro, notions et définitions ||
 
-
|-
 
-
| semaine 4 - 25.01    || RB CM2 représentation et premiers algo (DFS) ||
 
-
|-
 
-
| semaine 5 - 01.02    || RB CM3 algos (détection de cycles, tri topologique)        || RB TP1 Cytoscape, DFS Python
 
-
|-
 
-
| semaine 6 - 08.02    || RB CM4 algos (BFS, Dijkstra, Floyd-Warshall)        ||
 
-
|-
 
-
| semaine 7 - 15.02    || RB CM5 algos (MST Kruskall et Prim, Marches aléatoires, TribeMCL, Motif / Kavosh)        || RB TP2 BFS, plus courts chemins
 
-
|-
 
-
| semaine 8 - 22.01    || RB CM6 Dessin        ||
 
-
|-
 
-
| semaine 9 - 29.02    ||                      ||  RB TP3 dessin, librairie igraph
 
-
|-
 
-
| semaine 10 - 07.03  || YQ Partitionnement et détection de communautés        || YQ TP4 détection de communautés
 
-
|}
 
-
-->
 
'''Supports de cours'''
'''Supports de cours'''
* [[Media:Traitement_de_graphes_et_reseaux_biologiques.pdf|Support de cours]]
* [[Media:Traitement_de_graphes_et_reseaux_biologiques.pdf|Support de cours]]
 +
* [[Media:Traitement_des_graphes_et_reseaux_biologiques_communautes_v2019.pdf‎‎|Support de cours (communautés)]]
<!--
<!--
* [[Media:Traitement_des_graphes_et_reseaux_biologiques_communautes_v2013.pdf|Support de cours (communautés)]]
* [[Media:Traitement_des_graphes_et_reseaux_biologiques_communautes_v2013.pdf|Support de cours (communautés)]]
-
-->
 
-
* [[Media:Traitement_des_graphes_et_reseaux_biologiques_communautes_v2015.pdf‎|Support de cours (communautés)]]
 
 +
-->
'''Supports de TD/TP:'''  
'''Supports de TD/TP:'''  
-
* [[M1 BBS Graphes TP Visualisation|TP]] Visualisation et exploration de graphes
+
* [[M1 BBS Graphes TP Visualisation|TP1]] Visualisation et exploration de graphes
-
* [[M1 BBS Graphes TP Librairie - Parcours de graphes|TP]] Librairie et parcours de graphes
+
* [[M1 BBS Graphes TP Librairie - Parcours de graphes|TP1-2-3-4]] Librairie et parcours de graphes
-
* [[M1 BBS Graphes TP Dessin et Introduction iGraph|TP]] Dessin de graphes et initiation à la librairie iGraph
+
* [[M1 BBS Graphes TP Librairies R|TP4]] Librairies R
-
* [[M1 BBS Graphes TP Recherche de communautés dans les graphes|TP]] Recherche de communautés dans les graphes
+
* [[M1 BBS Graphes TP Recherche de communautés dans les graphes|TP5]] Recherche de communautés dans les graphes
 +
* [[M1 BBS Graphes TP Dessin et Introduction iGraph|TP archivé]] Dessin de graphes et initiation à la librairie iGraph
-
'''Projets 2016-17'''
+
 
 +
'''Projets 2019-20'''
* [[M1 BBS Graphes - Projets|Enoncé du projet]]
* [[M1 BBS Graphes - Projets|Enoncé du projet]]
 +
'''Liens:'''
'''Liens:'''
 +
Logiciels
* [http://cytoscape.org/ Cytoscape] (et [http://cytoscapeweb.cytoscape.org/ Cytoscape Web] mais un peu dépassé maintenant)
* [http://cytoscape.org/ Cytoscape] (et [http://cytoscapeweb.cytoscape.org/ Cytoscape Web] mais un peu dépassé maintenant)
-
* [http://tulip.labri.fr/TulipDrupal/ Tulip]
+
* [http://tulip.labri.fr/TulipDrupal/ Tulip] librairie C/C++ pour le traitement et la visualisation de graphes
* [https://gephi.org/ Gephi]
* [https://gephi.org/ Gephi]
-
* [http://igraph.org/ igraph]
+
 
 +
Librairies
 +
* [http://igraph.org/ igraph] R, python, ...
 +
* [http://networkx.github.io NetworkX] python
 +
* [https://graph-tool.skewed.de graph-tool] python
 +
* [https://www.bioconductor.org/packages/release/bioc/html/STRINGdb.html Bioconductor/STRINGdb] interface STRINGdb et R igraph
 +
 
 +
Serveurs & Banques
* [http://bioinformatics.ai.sri.com/ptools/ Pathway tools]
* [http://bioinformatics.ai.sri.com/ptools/ Pathway tools]
-
* [http://deim.urv.cat/~sgomez/radatools.php Radatools]
 
-
* [http://rsat.bigre.ulb.ac.be/rsat/index_neat.html NeAT]
 
* [http://www.metacyc.org/ METACYC]
* [http://www.metacyc.org/ METACYC]
* [http://string-db.org/ STRING]
* [http://string-db.org/ STRING]
-
* [https://www.bioconductor.org/packages/release/bioc/html/STRINGdb.html Bioconductor/STRINGdb] interface STRINGdb et R igraph
+
* [http://deim.urv.cat/~sgomez/radatools.php Radatools]
* [http://regulondb.ccg.unam.mx/ RegulonDb]
* [http://regulondb.ccg.unam.mx/ RegulonDb]
* [http://metanetx.org/ MetaNetX]
* [http://metanetx.org/ MetaNetX]
 +
 +
Formats
* Format GraphML http://graphml.graphdrawing.org/ et http://graphml.graphdrawing.org/primer/graphml-primer.html
* Format GraphML http://graphml.graphdrawing.org/ et http://graphml.graphdrawing.org/primer/graphml-primer.html
 +
 +
Autres
 +
* https://kateto.net/network-visualization Visu avec différents environnements et librairies
 +
* Visualisation de l'algorithme Floyd-Warshall https://www.cs.usfca.edu/~galles/visualization/Floyd.html
 +
* [http://exercism.io exercism.io] : améliorer son niveau de programmation dans différents langages (notamment R)
 +
* [http://rosalind.info rosalind] : apprentissage python en bioinformatique
'''Références'''
'''Références'''
Line 517: Line 625:
* <i>Kavosh: a new algorithm for finding network motifs</i>, Kashani <i>et al.</i>, BMC Bioinformatics, 2009. DOI:10.1186/1471-2105-10-318
* <i>Kavosh: a new algorithm for finding network motifs</i>, Kashani <i>et al.</i>, BMC Bioinformatics, 2009. DOI:10.1186/1471-2105-10-318
* <i>Pathway discovery in metabolic networks by subgraph extraction</i>, Faust <i>et al.</i>, Bioinformatics, 1211-1218, 2010. DOI:10.1093/bioinformatics/btq105
* <i>Pathway discovery in metabolic networks by subgraph extraction</i>, Faust <i>et al.</i>, Bioinformatics, 1211-1218, 2010. DOI:10.1093/bioinformatics/btq105
 +
 +
<!--
 +
'''Emploi du temps 2015-16'''
 +
Les CM ont lieu en salle S20, les TP en salle 4TP4-P1.
 +
{| class="wikitable"
 +
!colspan="4"|EDT M1 Traitement de graphes et réseaux biologiques
 +
|-
 +
|                    || CM mardi 15h45-17h45 en S20    || TP mercredi 13h30-17h30 en 4TP4-P1
 +
|-
 +
| semaine 3 - 18.01    || RB CM1 Intro, notions et définitions ||
 +
|-
 +
| semaine 4 - 25.01    || RB CM2 représentation et premiers algo (DFS) ||
 +
|-
 +
| semaine 5 - 01.02    || RB CM3 algos (détection de cycles, tri topologique)        || RB TP1 Cytoscape, DFS Python
 +
|-
 +
| semaine 6 - 08.02    || RB CM4 algos (BFS, Dijkstra, Floyd-Warshall)        ||
 +
|-
 +
| semaine 7 - 15.02    || RB CM5 algos (MST Kruskall et Prim, Marches aléatoires, TribeMCL, Motif / Kavosh)        || RB TP2 BFS, plus courts chemins
 +
|-
 +
| semaine 8 - 22.01    || RB CM6 Dessin        ||
 +
|-
 +
| semaine 9 - 29.02    ||                      ||  RB TP3 dessin, librairie igraph
 +
|-
 +
| semaine 10 - 07.03  || YQ Partitionnement et détection de communautés        || YQ TP4 détection de communautés
 +
|}
 +
-->
==== Fouille de données (EMBIA2DM) ====
==== Fouille de données (EMBIA2DM) ====
Line 571: Line 705:
'''Projet'''
'''Projet'''
<!-- * [[M1 MABS BBS Data Mining Projet|Enoncé]] du projet -->
<!-- * [[M1 MABS BBS Data Mining Projet|Enoncé]] du projet -->
-
* [[silico:enseignement/m1/datamining/projet/sujet.html|Sujet]] 2016-17
+
* [[silico:enseignement/m1/datamining/projet/sujet.html|Sujet]]
 +
 
 +
* Alexia & Antoine : classification des gènes → fait ou non partie d'un système ABC (données: Genes, Domains, Orthology ; méthodes: decision tree & bayesian)
 +
* Aurélien & Baptiste : gènes identifiés ABC → attribution d'une sous-famille
 +
* Quentin & Jérémy : comparaison de méthode de clustering (k-means, hiérarchique des différents systèmes ABC) en fonctions de leurs organisations en domaines
 +
* Sophie-Carole & Valentine : clustering des protéines ABC (attributs à spécifier) pour leur réassemblage en systèmes ABC (stratégie d'assemblage à préciser)
 +
* Refka & Houyem : structure en domaines à partir des protéines identifiées ABC
 +
* Laura BS & Tomas : Evaluation et comparaison de méthodes de classification (class & données à préciser)
 +
* Laura DF & Safia : Etude des profils de domaines correspondant aux différents domaines présents chez les partenaires de systèmes ABC
 +
 
'''Liens'''
'''Liens'''
Line 592: Line 735:
* <i>Data Mining: Concepts and Techniques</i>, J. Han and M. Kamber, 2006.
* <i>Data Mining: Concepts and Techniques</i>, J. Han and M. Kamber, 2006.
* ''GENECODIS: a web-based tool for finding significant concurrent annotations in gene lists'', Carmona-Saez ''et al.'', Genome Biology, 2007.
* ''GENECODIS: a web-based tool for finding significant concurrent annotations in gene lists'', Carmona-Saez ''et al.'', Genome Biology, 2007.
 +
* Petit cours d'autodéfense intellectuelle, Normand Baillargeon, 2006
=== Master 1 - MEEF ===
=== Master 1 - MEEF ===
Line 599: Line 743:
'''Supports de TD :'''
'''Supports de TD :'''
* [[Media:1516_Gaulin_TD_PlantesDom.pdf|TD Plantes Domestiquees]]
* [[Media:1516_Gaulin_TD_PlantesDom.pdf|TD Plantes Domestiquees]]
 +
<!--
 +
 +
* [[Media:15_TD_Dom_CORRECTION.pdf|TD Plantes Domestiquees Correction]]
* [[Media:15_TD_Dom_CORRECTION.pdf|TD Plantes Domestiquees Correction]]
 +
-->
 +
-
'''Supports de Cours :'''
 
-
* [[Media:1617_PlantesDomes.pdf|CM Plantes Domestiquees]]
 
<!--
<!--
 +
* [[Media:1617_PlantesDomes.pdf|CM Plantes Domestiquees]]
 +
-->
-->
== Master 2 ==
== Master 2 ==
 +
=== Master 2P Diagnostic moléculaire en microbiolgy ===
 +
=====Supports de cours =====
 +
* [[Media:annotation2_M2Diag_2019.pdf|Annotation génomes bactériens (Gwennaele Fichant)]]
 +
* [[Media:Phylogenie_Definitions_2018_M2Diag.pdf|Définitions en phylogénie (Gwennaele Fichant)]]
 +
* [[Media:Introduction_Phylogenie_2019_M2Diag.pdf|Introduction à la reconstruction phylogénétique (Gwennaele Fichant)]]
 +
<!--* [[Media:annotation1_M2Diag_2018.pdf|Annotation partie 1 (Gwennaele Fichant)]]
 +
* [[Media:annotation2_M2Diag_2018.pdf|Annotation partie 2 (Gwennaele Fichant)]]
 +
* [[Media:Blast_2016.pdf|Recherche par similarité dans les bases de données (cours de L3 Bioanalyse)]]-->
-
=== Master 2 - Bioinformatique et Biologie des Systèmes ===
+
=====Tutoriels de TP=====
 +
*[[silico:enseignement/m1-bioinfo/BG/TD_annotation/Tutorial_annotation_v1_2019.html|Annotation d'un fragment génomique bactérien]]
-
* [[M2BBS - Atelier Système]]  
+
* [[silico:enseignement/m1-mabs/EvolMol/TD1/index.html|Analyse évolutive de la cascade de régulation de la compétence chez les Streptocoques]]
 +
* [[Media:Introduction_competence_2017.pdf|Petit topo d'introduction sur la régulation de la compétence chez ''S. pneumoniae'']]
 +
 
 +
* [[silico:enseignement/m2pro-diag/Bioinfo/TD_16srRNA/16SRNA_Tutorial_de _BioInformatique.htm|Identification des bactéries à l'aide de l'ARNr 16S]]
 +
 
 +
=== Master 2 - Bioinformatique et Biologie des Systèmes ===
<!-- * [[silico:enseignement/m2pro-bioinfo/Annotation.html|TD Annotation Artemis]]
<!-- * [[silico:enseignement/m2pro-bioinfo/Annotation.html|TD Annotation Artemis]]
Line 618: Line 781:
-->
-->
 +
===== Atelier système =====
 +
* [[M2BBS - Atelier Système]]
 +
 +
==== Atelier Chipseq ====
 +
**[[silico:enseignement/m2BBS/ChipSeq/TP_CHIPSEQ_2019_M2Bioinfo_FolderEtudiants.tar.gz|données TP]]
 +
 +
===== Atelier Galaxy =====
 +
 +
* http://genoweb.toulouse.inra.fr/~formation/8_Galaxy_Admin/2019/
===== UE Communication =====
===== UE Communication =====
 +
=====liste des publications à présenter en préparation des ateliers:=====
=====liste des publications à présenter en préparation des ateliers:=====
-
'''Chaque publication sera choisie par deux étudiant(e)s. La présentation de la publication est personnelle. Donc chaque personne préparera une présentation powerpoint (ou pdf), diapositives en anglais, de 15 minutes qui sera suivie de 10 minutes de questions. Attention, ne pas oublier de récupérer les supplementary data si il y en a et qu'ils ne vous sont pas fournis et bien entendu de les consulter. La présentation devra faire ressortir la problématique abordée (question posée et contexte), la démarche bioinformatique adoptée, les résultats sous forme synthétisée avec choix pertinent des figures pour illustrer votre propos et la conclusion/discussion.
+
'''Chaque publication sera choisie par deux étudiant(e)s. La présentation de la publication est personnelle. Donc chaque personne préparera une présentation powerpoint (ou pdf), diapositives en anglais, de 15 minutes qui sera suivie de 10 minutes de questions. La présentation et les questions se feront en français. Attention, ne pas oublier de consulter et de récupérer les supplementary data. La présentation devra faire ressortir la problématique abordée (question posée et contexte), la démarche bioinformatique adoptée, les résultats sous forme synthétisée avec choix pertinent des figures pour illustrer votre propos et la conclusion/discussion.
'''
'''
-
* '''Atelier Biologie des Systèmes'''
+
* '''Atelier Métabolomique'''
** Article 1 :
** Article 1 :
-
*** [[Media:Toni_et_al_2011.pdf|Toni_2011_BMC_System_Biology]]
+
*** [[Media:Frezza2011.pdf|Haem oxygenase is synthetically lethal with the tumour suppressor fumarate hydratase]]
-
*** [[Media:2011_Toni_supplement.pdf|Toni_2011_BMC_System_Biology_SupData]]
+
* '''Atelier ChipSeq'''
* '''Atelier ChipSeq'''
** Article 1 :  
** Article 1 :  
-
*** [[Media:Jager-2015.pdf|Jäger_Nature_communication_2015]]
+
*** [[Media:GenomeBiol2008.pdf|Model-based Analysis of ChIP-Seq (MACS)]]
 +
*** [[Media:MACS_Sup_data.pdf |Supplementary information]]
** Article 2 :  
** Article 2 :  
-
*** [[Media:Pugh.pdf|Rhee_and_Pugh_Cell_2011]]
+
*** [[Media:Buenrostro_2018.pdf|Integrated Single-Cell Analysis Maps the Continuous Regulatory Landscape of Human Hematopoietic Differentiation]]
 +
*** Supplementary information à récupérer sur https://www.sciencedirect.com/science/article/pii/S009286741830446X?via%3Dihub
-
* '''Atelier Modélisation Moléculaire'''
+
* '''Atelier Phylogénomique'''
** Article 1 :  
** Article 1 :  
-
*** [[Media:Kossida_2013.pdf|Vlachakis_and_Kossida_PeerJ_2013]]
+
*** [[Media:Thakur_Guttman_2016.pdf| A De-Novo Genome Analysis Pipeline (DeNoGAP) for large-scale comparative prokaryotic genomics studies]]
 +
*** Supplementary information à récupérer sur  https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-016-1142-2
 +
** Article 2
 +
***[[Media:Ali_et_al_2019.pdf|Identifying Clusters of High Confidence Homologies in Multiple Sequence Alignments]]
-
* '''Atelier Genome'''
+
* '''Atelier Modélisation'''
** Article 1 :
** Article 1 :
-
*** [[Media:Rajagopal_al_Plos_Computational_2013.pdf|Rajagopal_al_Plos_Computational_2013]]
+
*** [[Media:Weyder_et_al_2018.pdf|Dynamic Modeling of Streptococcus pneumoniae Competence Provides Regulatory Mechanistic Insights Into Its Tight Temporal Regulation]]
 +
*** Supplementary information à récupérer sur https://www.frontiersin.org/articles/10.3389/fmicb.2018.01637/full#supplementary-material
 +
** Article 2 :
 +
*** [[Media:Li_et_al_2008.pdf|A Quantitative Study of the Division Cycle of Caulobacter crescentus Stalked Cells]]
 +
*** Supplementary information à récupérer sur https://journals.plos.org/ploscompbiol/article?id=10.1371/journal.pcbi.0040009
 +
 
===== Calendrier des présentations =====
===== Calendrier des présentations =====
{| class="wikitable"
{| class="wikitable"
-
!colspan="2"|EDT présentation des articles (les noms sont donnés pour rappel mais ordre de passage indifférent)
+
!colspan="5"|EDT présentation des articles (les noms sont donnés pour rappel mais ordre de passage indifférent sauf Fulya 1ère)
|-
|-
-
|lundi 10 octobre 9h30-10h30 :
+
|lundi 23 septembre 9h30-11h30 :
-
|article Atelier Modélisation Moléculaire (Alexandra, Soukaïna))
+
|articles Atelier Métabolomique
 +
|article 1 : 9H30-11h00 (Juliette, Matthieu, Marine)
 +
|
 +
||Commentaires : 11h-11h30
|-
|-
-
|lundi 10 octobre 10h30-11h45 : (pause de 11h à 11h15)
+
|lundi 23 septembre 13h30-16h :
-
| article Atelier Biologie des Systèmes (Leila, Raphael)
+
|articles Atelier Modélisation
 +
|article 1 : 13H30-14h30 (Alex, Soufiane)
 +
|article 2 : 14h30-15h30 (Eve, Clara)
 +
|Commentaires : 15h30-16h
|-
|-
-
|lundi 10 octobre 11h45-12h35 :
+
|mardi 24 septembre 9h30-12h :  
-
| article Atelier Génome (David, Adrien)
+
|article Atelier Phylogénomique
 +
|article 2 : 9H30-10h30 (Tristan, Geoffrey)
 +
|article 1 : 10H30-11h30 (Elise, Chloé)
 +
|Commentaires : 11h30-12h
|-
|-
-
|lundi 10 octobre 14h30-17h :
+
|mardi 24 septembre 14h-16h30 :
-
| articles Atelier ChipSeq (Emilie, Laurent,Léa,Thomas)
+
|articles Atelier ChipSeq
 +
|article 1 : 14h-15h (Marion, Julien)
 +
|article 2 : 15h-16h (Nicolas, Cheryn)
 +
|Commentaires : 16h-16h30
|}
|}
===== Intégration de Données Hétérogènes - Partie R. Barriot =====
===== Intégration de Données Hétérogènes - Partie R. Barriot =====
-
* [[Media:M2BBS - Integration de Donnees Heterogenes.pdf|Support de cours]]
+
* [[Media:M2BBS - Integration de Donnees Heterogenes - Generalites.pdf|Approches]]
 +
* [[Media:M2BBS - Integration de Donnees Heterogenes - Enrichissement.pdf|Enrichissement]]
 +
* [[Media:M2BBS - Integration de Donnees Heterogenes - Priorisation.pdf|Fusion de données et priorisation de gènes candidats]]
* [[M2BBS - IDH|Mise en oeuvre]]  
* [[M2BBS - IDH|Mise en oeuvre]]  
* [[M2BBS Integration de Donnes Heterogenes - Projets|Projets IDH]]
* [[M2BBS Integration de Donnes Heterogenes - Projets|Projets IDH]]
 +
 +
===== Atelier Génétique Satistique - S. Boitard =====
 +
Support de cours et TD:
 +
* [[Media:coal_cours.pdf|Coalescence : principe et bases théoriques]] '''
 +
* [[Media:coal_td.pdf|TD de génétique des populations]] '''
 +
* [[Media:tp_struc.pdf|TP : Diversité génétique d’une population structurée]] '''
 +
<!-- * [[Media:Mol_Biol_Evol-1999-Pritchard-1791-8.pdf|article : investigation de l'histoire démographique du chromosome Y par analyse des loci microsatellite]] '''-->
 +
* [[Media:cours_tp_hapFLK.pdf|cours et TP de détection de locus sous sélection positive]] '''
 +
 +
'''TP :'''
 +
*[[Media:tp_coal.pdf|TP : simulations de données génétiques par coalescence fichier format pdf]] '''
 +
*[[silico:enseignement/m2BBS/Genet_Stat/tp_coal.html|TP : simulations de données génétiques par coalescence fichier format html]]
 +
*[[Media:tp_abc.pdf|TP estimation de paramètres par une approche ABC]] '''
 +
<!-- *[[https://github.com/willyrv/BioInfoCours]] autres documents -->
 +
 +
=====Atelier Phylogénomique=====
 +
Intervenants : Hélène Chiapello, Claire Hoede et Yves Quentin
 +
 +
[http://silico.biotoul.fr/p/Atelier_Phylog%C3%A9nomique Atelier de Phylogénomique]
 +
 +
===== Biologie des Systèmes - R. Barriot =====
 +
* [[Media:GRNs.pdf|Réseaux de régulation]] '''
 +
* [[M2 BBS TP GRNs]]
 +
 +
 +
===== Biologie des Systèmes - G. Czaplicki =====
 +
 +
* [[Media:document_GC.pdf|Support de cours]] '''
 +
 +
Fichiers avec les codes :
 +
* [[Media:banana.m|banana.m]] '''
 +
* [[Media:ftest.m|ftest.m]] '''
 +
* [[Media:Rate.m|Rate.m]] '''
 +
* [[Media:SMarquardt.m|SMarquardt.m]] '''
 +
* [[Media:compet.dat|compet.dat]] '''
===== Biologie des Systèmes - G. Fichant =====
===== Biologie des Systèmes - G. Fichant =====
Support de cours:
Support de cours:
-
* [[Media:Intro_BioSyst.pdf|Short general introduction to system biology]] '''
+
* [[Media:Intro_BioSyst_2017.pdf|Introduction to system biology]] '''
-
* [[Media:SCAN_rappel_enzymo.pdf|Petit rappel enzymologie partie 1 ]]'''
+
* [[Media:Rappel_enzymo_v1.pdf|Petit rappel enzymologie]]'''
-
* [[Media:Rappel_enzymo_v1.pdf|Petit rappel enzymologie partie 2 ]]'''
+
* [[Media:SCAN_rappel_enzymo.pdf|Complément rappel enzymologie]]'''
-
* [[Media:network_motifs.pdf|Two and three nodes network motifs in transcriptional networks]]'''
+
<!--* [[Media:network_motifs.pdf|Two and three nodes network motifs in transcriptional networks]]'''-->
-
* [[Media:Petri_net_2015.pdf|Introduction to Petri net models]]'''
+
* [[Media:Petri_net_2019.pdf|Introduction to Petri net models]]'''
 +
* [[Media:Modele_stochastique.pdf|Introduction to stochastic simulation]]'''
 +
* [[Media:parameter_estimation_2019.pdf|Introduction parameter estimation]]'''
* [[Media:Intro_PL_2015.pdf|Introduction to Piece-wise linear differential equation models]]'''
* [[Media:Intro_PL_2015.pdf|Introduction to Piece-wise linear differential equation models]]'''
* [[Media:Model_analysis.pdf| System dynamic analyses ]]'''
* [[Media:Model_analysis.pdf| System dynamic analyses ]]'''
Line 680: Line 913:
'''TP :'''
'''TP :'''
 +
* [[Media:CopasiUserguide-20100803-1.pdf|Copasi user guide]]
 +
* Lien vers le site de Snoopy : https://www-dssz.informatik.tu-cottbus.de/DSSZ/Software/Snoopy
 +
*'''TP1 : modeling of the psp response when cell envelop  is damaged'''
*'''TP1 : modeling of the psp response when cell envelop  is damaged'''
-
** [[Media:psp_system_dm.txt|membrane data]]
+
** [[Media:Toni_et_al_2011.pdf|article support]]
 +
** [[Media:constante_stochastic_2017-18.png|constantes stochastiques]]
 +
** [[Media:modele_psp_save_2017-18.spn|Modèle stochastique corrigé]]
 +
<!--** [[Media:psp_system_dm.txt|membrane data]]
** [[Media:psp_system_hBCA.txt|hBCA data]]
** [[Media:psp_system_hBCA.txt|hBCA data]]
** [[Media:psp_system_olg.txt|olg data]]
** [[Media:psp_system_olg.txt|olg data]]
** [[Media:psp_system_hBCAF.txt|hBCAF data]]
** [[Media:psp_system_hBCAF.txt|hBCAF data]]
-
** [[Media:psp_system_hBcCcA.txt|hBcAcCc data]]
+
** [[Media:psp_system_hBcCcA.txt|hBcAcCc data]]-->
-
*'''TP2 : modeling of the regulation of lactose operon :'''
+
 
-
** [[Media:operon_lactose.pdf|Short biological description of the lactose operon regulation]]
+
 
-
** [[Media:constantes.txt|constant file]]
+
*'''TP2 : modeling of the repressilator:'''
 +
** [[Media:tp_repressilator_2019.pdf|Short description of the repressilator regulation]]
 +
** [[Media:repressilator_continu_2018_time_serie_500.csv|protein time series data]]
 +
** [[Media:repressilator_continu_2018.cpn|Modèle corrigé continu avec Snoopy]]
 +
** [[Media:repressilator_prot.cps|Modèle corrigé Copasi]]
 +
** [[Media:repressilator.Rmd|script R pour intégration ODE]]
 +
 
 +
 
 +
<!-- ** [[Media:constante_stochastique.png|stochastic constant file]]
 +
** [[Media:constante_continu.png|ODE parameter file]] -->
 +
 
 +
*'''TP3 : modeling phosphate regulation in enterobacteria:'''
 +
** [[Media:TP_phosphate_new_2018.pdf|Short biological description of the phosphate regulation]]
 +
** [[Media:PN_extended_phosphate.xpn|Modèle "extended Petri Net" corrigé]]
 +
** [[Media:modele_stochastique_switch.spn|Modèle stochastique corrigé]]
 +
 
 +
 
 +
*'''TP4 : modeling of the regulation of lactose operon :'''
 +
** [[Media:operon_lactose_description_2018.pdf|Short biological description of the lactose operon regulation]]
 +
** [[Media:operon_lac_2018_last.spn|Modèle stochastique corrigé]]
 +
<!-- ** [[Media:constantes_2017.txt|stochastic constant file]]
 +
** [[Media:Constante_parameter_lactose_stochastique_2017.PNG|screen shot of the constant definition in the model]]-->
=== Master 2 - [http://sciences-vegetales.univ-tlse3.fr/presentation-m2-adam-609174.kjsp?RH=1449138073206&RF=1450299526893 ADAM] (Adaptation, Développement et Amélioration des plantes en présence de Microorganismes)===
=== Master 2 - [http://sciences-vegetales.univ-tlse3.fr/presentation-m2-adam-609174.kjsp?RH=1449138073206&RF=1450299526893 ADAM] (Adaptation, Développement et Amélioration des plantes en présence de Microorganismes)===
Line 696: Line 956:
'''Documents, partie E. Gaulin'''
'''Documents, partie E. Gaulin'''
-
* [[M2R_BV|Clonage in silico]]
+
* [[M2R_ADAM|Clonage in silico_BenchLing]]
 +
* [[M2R_BV|Clonage in silico_pDRAW]]
 +
 +
<!--
 +
-------------------------------------------------------
 +
'''Examen 2019-2020'''
 +
 +
 +
'''Partie E. Gaulin'''
 +
 +
Veuillez trouver ci-dessous, la séquence fasta de l'ORF du gène X (1 171 bases) que l'on souhaite cloner dans le vecteur pCAMBIA
 +
 +
'''>ORF_X'''
 +
 +
ACTTCCAAATTCTAGTATATGTAATCCTTTT
 +
GTTCGGGTTCATGATCGAATTCCAAAGAGTGGAAAACAAGCAAAAGGTTAAATATACATG
 +
CCATTTTTGGAGCTTTCGAGCTCATAACACAGGTGAGCGCGACGAATGGATCCCTCGCTA
 +
ATAACATCATGGTCGTGGGCGCCGTCCTTGCGGCGCTCGTCGCCGGCGGGTCGTGCGGGC
 +
CCCCGAAGGTGCCACCCGGCCCCAACATCACCACCAACTACAACGGCAAGTGGCTCACCG
 +
CTAGGGCCACCTGGTACGGTCAGCCCAACGGTGCCGGCGCTCCTGACAACGGCGGTGCGT
 +
GCGGGATCAAGAACGTGAACCTGCCACCCTACAGCGGCATGACGGCGTGCGGCAACGTCC
 +
CCATCTTCAAGGACGGCAAGGGCTGCGGCTCATGCTACGAGGTGAGATGCAAGGAAAAAC
 +
CTGAGTGCTCGGGCAATCCAGTCACGGTGTACATCACTGACATGAACTACGAACCTATCG
 +
CTCCCTACCACTTCGACTTGAGCGGCAAGGCCTTCGGCTCCCTGGCAAAGCCCGGGCTCA
 +
ACGACAAGATTCGCCACTGCGGCATCATGGACGTCGAGTTCAGAAGGGTGCGATGCAAGT
 +
ACCCCGCCGGGCAGAAGATCGTGTTCCACATCGAGAAGGGCTGCAACCCCAACTACCTGG
 +
CCGTGCTGGTGAAGTATGTGGCGGACGACGGCGACATCGTGCTGATGGAAATCCAGGACA
 +
AGTTGTCGGCTGAGTGGAAGCCCATGAAGCTCTCTTGGGGCGCCATCTGGAGGATGGACA
 +
CTGCCAAGGCGCTCAAGGGCCCCTTCTCCATCCGCCTCACCAGCGAGTCCGGCAAGAAGG
 +
TCATCGCCAAAGACGTCATCCCGGCGAACTGGAGACCCGATGCCGTCTACACTTCCAACG
 +
TCCAATTTTACGTAACTTTGAATTCCCTTCGATTCATCCGGCACAGCGGGCTATGGACCT
 +
TCAGCAGCAAGCTAATTAAGTTGGCAGCATGCACCGCTAACCTTATATACTACTGAGACT
 +
TCCAAATTCTAGTATATGTAATCCTTTTGTTCGGGTTCATGATCGAATTCCAAAGAGTGG
 +
AAAACAAGCAAAAGGTTAAATATACATGCCATTTTTGGAAGCTTGGCTTTCGAGGGTACC
 +
CCTGATAGTT
 +
 +
 +
'''Partie C. Mathé'''
 +
* [http://genoweb.toulouse.inra.fr/~mathe/M2RBV/Exam_Blast.htm Lien vers un BLAST sauvegardé]
 +
 +
 +
'''Partie C. Albenne'''
 +
 +
*[[Media:PGIP.pdb|Lien vers le PGIP]]
 +
 +
 +
-------------------------------------------
 +
 +
 +
'''Examen 2018-2019'''
 +
 +
'''Partie E. Gaulin'''
 +
* [[M2R|Cartes et Sites de Restriction]]
 +
 +
'''Partie C. Mathé'''
 +
* [http://genoweb.toulouse.inra.fr/~mathe/M2RBV/Exam_Blast.htm Lien vers un BLAST sauvegardé]
 +
 +
'''Partie C. Albenne'''
 +
*[[Media:M2R_2018-Albenne.pdf|Sujet C Albenne]]
 +
 +
 +
*[[Media:EXPB1.doc|EXPB1]]
 +
*[[Media:2hcz.dsv|Structure]]
 +
 +
 +
 +
---------------------------------------------
 +
 +
 +
'''Examen 2017, partie E. Gaulin''' <br>
 +
 +
'''Documents, sujet C Albenne'''
 +
*[[Media:M2R_2017-Albenne.pdf|Sujet C Albenne]]
'''Examen 2016, partie E. Gaulin''' <br>
'''Examen 2016, partie E. Gaulin''' <br>
Line 703: Line 1,035:
*[[M2ADAM|Cartes et Sites de Restriction]]
*[[M2ADAM|Cartes et Sites de Restriction]]
-
<!--
 
'''Examen 2015'''
'''Examen 2015'''
'''Documents, partie E. Gaulin'''
'''Documents, partie E. Gaulin'''
* [[M2R|Cartes et Sites de Restriction]]
* [[M2R|Cartes et Sites de Restriction]]
-
-->
+
 
-
'''Documents, partie C. Mathé'''
+
-
* [http://snp.toulouse.inra.fr/~mathe/M2RBV/Exam_Blast.htm Lien vers un BLAST sauvegardé]
+
'''Documents, partie C. Albenne'''
'''Documents, partie C. Albenne'''
* [[Media:EXP1.doc|Sequence fasta EXPB1]]
* [[Media:EXP1.doc|Sequence fasta EXPB1]]
* [[Media:2HCZ.pdb|Structure PDB]]
* [[Media:2HCZ.pdb|Structure PDB]]
 +
 +
-------------------------------------------------
 +
 +
==== Biologie Computationnelle (2019) ====
 +
 +
* [[M2R_ADAM|In silico cloning]]
 +
 +
-->
 +
 +
= Culture =
 +
 +
* Une histoire de tout ou presque... Bill Bryson, Payot, coll. "Petite Bibliothèque Payot" n° 851, 2012 (ISBN: 9782228907576)
 +
* Norman Baillargeon - Petit cours d'autodéfense intellectuelle, Éditions Lux, collection Instinct de Liberté, 2005. (ISBN: 2-895960-44-5)
 +
* Faire l'économie de la haine, Alain Deneault, 2018, Ecosociete Eds, coll. Polemos
 +
* Comment tout peut s'effondrer. Petit manuel de collapsologie à l'usage des générations présentes. 2015. Pablo Servigne, :Raphaël Stevens. seuil
 +
* Les sentiers de l'utopie, I. Fremeaux et J. Jordan, 2012.
= F.A.Q. =
= F.A.Q. =

Current revision as of 07:55, 2 July 2020

Contents

Contrôles terminaux en distanciel 2020

Bioinformatique pour la génomique M1 Bioinfo CT session 2 2 juillet 10h-12h30 : sujet CT Biooinformatique pour la Génomique

Licence 2 et 3 Biologie

Bioinformatique - Option L2-L3 2B2M-BCP-BOPE

UE en option avec différents codes :

  • L2 2B2M : EDSVB4IM
  • L2 BCP : EDSVA4HM
  • L2 BOPE : EDSVC4MM
  • L3 BOPE : ELSVC6JM

Emploi du temps 2019-20

Aussi disponible sur https://calendar.google.com/calendar/embed?src=lic.bioinfo%40gmail.com&ctz=Europe/Paris


Les groupes de TD et TP 2019-20 sont disponibles sur moodle : https://moodle.univ-tlse3.fr/course/view.php?id=2518


EDT L2-L3 2B2M-BCP-BOPE Bioinformatique
CM 3TP2-Einstein TD TP
semaine 04 - 20/01 13h30-15h40 R. Barriot Bioinfo générale
semaine 05 - 27/01 13h30-15h40 F. Delavoie Imagerie 15h50-18h00 groupes gTP1 en 4TP4-P1 & gTP2 en 4TP4-P15
18h10-20h20 groupe gTP3 en 4TP2-M6
semaine 06 - 03/02 13h30-15h40 R. Barriot Bases de Données 15h50-18h00 U2-116 groupe gTD1
18h10-20h20 U2-116 groupe gTD2
semaine 07 - 10/02 13h30-15h40 groupe gTP1 en 4TP2-M7
15h50-18h00 groupe gTP2 en 4TP4-P15
18h10-20h20 groupe gTP3 en 4TP2-M6
semaine 08 - 17/02
semaine 09 - 24/02 13h30-15h40 M. Bonhomme 15h50-18h00 groupes gTP1 en 4TP4-P1 & gTP2 en 4TP4-P15
18h10-20h20 groupe gTP3 en 4TP2-M6
semaine 10 - 02/03 13h30-15h30 Contrôle continu en 4A-Leclerc
semaine 11 - 09/03 13h30-15h40 G. Fichant SysBio 15h50-18h00 groupes gTP1 en 4TP4-P1 & gTP2 en 4TP4-P15
18h10-20h20 groupe gTP3 en 4TP2-M6
semaine 12 - 16/03 13h30-15h40 gTD1 en U2-220
15h50-18h00 gTD2 en U2-219
semaine 13 - 23/03 13h30-15h40 groupe gTP1 en 4TP2-M7
15h50-18h00 groupe gTP2 en 4TP4-P15
18h10-20h20 groupe gTP3 en 4TP2-M6
semaine 14 - 30/03 13h30-15h30 Contrôle terminal anticipé en Eintein





Supports de cours

Sujets de TD/TP

BioAnalyse L3 BCP

Planning des Enseignements L3 BCP semestre 6 (ELSV6CM1)

Cours

TPs

Exemples de contrôle continu corrigé

BioAnalyse L3 2B2M

TPs

Licence 3 Biologie des Organismes des populations et Ecosystemes (BOPE)

Du génome à la sélection des plantes (ELSVC5EM)

Initiation à la 'Bioanalyse'


Master

Master 1

Master 1 - Bioinformatique et Biologie des Systèmes + Biologie Végétale ADAM

Génomique Evolutive et Phylogénie

Supports de TD/TP :

Medicago SNPs sequences
Drosophile sequences
Primates lysozymes sequences

Traitement de données biologiques (EMBIA1FM)

Supports de cours :

Supports de TD/TP :


Liens

Génétique Evolutive et Quantitative (EMBIA1GM)

Support de cours:

Supports de TD/TP :

Master 1 - Bioinformatique et Biologie des Systèmes + Biotechnologies

Evolution Moléculaire (EMBIA2EM)

Supports de cours :

Support TP :

Support TD :

Exemple CC corrigé :


Master 1 - Bioinformatique et Biologie des Systèmes


Bioinformatique pour la Génomique (EMBIA1DM)

Supports de cours :

Tutoriels de TP :

Aide pour la réalisation du projet annotation

Contrôle continu :

  • Rapport de TP sur le design d'un HMM à rendre au plus tard le lundi 14 octobre. M'envoyer par courrier le rapport en format pdf ainsi que le fichier en format texte comportant votre modèle avant estimation des probabilités.


Mathématique pour la Biologie (EMBIA1EM)

Sujets de TP :

  • TD Calcul matriciel
  • TD ACP
  • TD Modélisation
  • TD Probabilités


Liens :

  • http://exercism.io : améliorer son niveau de programmation dans différents langages (notamment R)

Références

  • Mathématiques pour les Sciences de la vie et de la Terre – C. David, S. Mustapha, F. Viens, N. Capron, edition Dunod

Projet 2019-20 :





Traitement de graphes et réseaux biologiques (EMBIA1KM)

Supports de cours

Supports de TD/TP:

  • TP1 Visualisation et exploration de graphes
  • TP1-2-3-4 Librairie et parcours de graphes
  • TP4 Librairies R
  • TP5 Recherche de communautés dans les graphes
  • TP archivé Dessin de graphes et initiation à la librairie iGraph


Projets 2019-20


Liens: Logiciels

Librairies

Serveurs & Banques

Formats

Autres

Références

  • Introduction to Algorithms, Corsen, Leiserson and Rivest, MIT Press and McGraw-Hill
  • Detection of Functional Modules From Protein Interaction Networks, Pereira-Leal, Enright and Ozounis, PROTEINS: Structure, Function, and Bioinformatics, 49-57, 2004.
  • An efficient algorithm for large-scale detection of protein families, Enright, Van Dongen and Ozounis, Nucleic Acids Research, 1575-84, 2002 PMID:11917018
  • Kavosh: a new algorithm for finding network motifs, Kashani et al., BMC Bioinformatics, 2009. DOI:10.1186/1471-2105-10-318
  • Pathway discovery in metabolic networks by subgraph extraction, Faust et al., Bioinformatics, 1211-1218, 2010. DOI:10.1093/bioinformatics/btq105


Fouille de données (EMBIA2DM)

Support de cours:

Sujets de TD/TP

  • TD Classification, validation croisée et clustering

Projet

  • Alexia & Antoine : classification des gènes → fait ou non partie d'un système ABC (données: Genes, Domains, Orthology ; méthodes: decision tree & bayesian)
  • Aurélien & Baptiste : gènes identifiés ABC → attribution d'une sous-famille
  • Quentin & Jérémy : comparaison de méthode de clustering (k-means, hiérarchique des différents systèmes ABC) en fonctions de leurs organisations en domaines
  • Sophie-Carole & Valentine : clustering des protéines ABC (attributs à spécifier) pour leur réassemblage en systèmes ABC (stratégie d'assemblage à préciser)
  • Refka & Houyem : structure en domaines à partir des protéines identifiées ABC
  • Laura BS & Tomas : Evaluation et comparaison de méthodes de classification (class & données à préciser)
  • Laura DF & Safia : Etude des profils de domaines correspondant aux différents domaines présents chez les partenaires de systèmes ABC


Liens

Références

  • Data Mining: Concepts and Techniques, J. Han and M. Kamber, 2006.
  • GENECODIS: a web-based tool for finding significant concurrent annotations in gene lists, Carmona-Saez et al., Genome Biology, 2007.
  • Petit cours d'autodéfense intellectuelle, Normand Baillargeon, 2006

Master 1 - MEEF

Sciences de la Vie (EE7BSVFM)

Supports de TD :


Master 2

Master 2P Diagnostic moléculaire en microbiolgy

Supports de cours
Tutoriels de TP

Master 2 - Bioinformatique et Biologie des Systèmes

Atelier système

Atelier Chipseq

Atelier Galaxy
UE Communication
liste des publications à présenter en préparation des ateliers:

Chaque publication sera choisie par deux étudiant(e)s. La présentation de la publication est personnelle. Donc chaque personne préparera une présentation powerpoint (ou pdf), diapositives en anglais, de 15 minutes qui sera suivie de 10 minutes de questions. La présentation et les questions se feront en français. Attention, ne pas oublier de consulter et de récupérer les supplementary data. La présentation devra faire ressortir la problématique abordée (question posée et contexte), la démarche bioinformatique adoptée, les résultats sous forme synthétisée avec choix pertinent des figures pour illustrer votre propos et la conclusion/discussion.


Calendrier des présentations
EDT présentation des articles (les noms sont donnés pour rappel mais ordre de passage indifférent sauf Fulya 1ère)
lundi 23 septembre 9h30-11h30 : articles Atelier Métabolomique article 1 : 9H30-11h00 (Juliette, Matthieu, Marine) Commentaires : 11h-11h30
lundi 23 septembre 13h30-16h : articles Atelier Modélisation article 1 : 13H30-14h30 (Alex, Soufiane) article 2 : 14h30-15h30 (Eve, Clara) Commentaires : 15h30-16h
mardi 24 septembre 9h30-12h : article Atelier Phylogénomique article 2 : 9H30-10h30 (Tristan, Geoffrey) article 1 : 10H30-11h30 (Elise, Chloé) Commentaires : 11h30-12h
mardi 24 septembre 14h-16h30 : articles Atelier ChipSeq article 1 : 14h-15h (Marion, Julien) article 2 : 15h-16h (Nicolas, Cheryn) Commentaires : 16h-16h30
Intégration de Données Hétérogènes - Partie R. Barriot
Atelier Génétique Satistique - S. Boitard

Support de cours et TD:

TP :

Atelier Phylogénomique

Intervenants : Hélène Chiapello, Claire Hoede et Yves Quentin

Atelier de Phylogénomique

Biologie des Systèmes - R. Barriot


Biologie des Systèmes - G. Czaplicki

Fichiers avec les codes :

Biologie des Systèmes - G. Fichant

Support de cours:


TP :





Master 2 - ADAM (Adaptation, Développement et Amélioration des plantes en présence de Microorganismes)

Biologie Computationnelle

Documents, partie E. Gaulin


Culture

  • Une histoire de tout ou presque... Bill Bryson, Payot, coll. "Petite Bibliothèque Payot" n° 851, 2012 (ISBN: 9782228907576)
  • Norman Baillargeon - Petit cours d'autodéfense intellectuelle, Éditions Lux, collection Instinct de Liberté, 2005. (ISBN: 2-895960-44-5)
  • Faire l'économie de la haine, Alain Deneault, 2018, Ecosociete Eds, coll. Polemos
  • Comment tout peut s'effondrer. Petit manuel de collapsologie à l'usage des générations présentes. 2015. Pablo Servigne, :Raphaël Stevens. seuil
  • Les sentiers de l'utopie, I. Fremeaux et J. Jordan, 2012.

F.A.Q.

  • Installation de igraph sur CentOS 6.7 en P0

Sous R, l'installation d'igraph échoue avec le protocole https, il faut donc choisir un mirroir avec le protocol http : choseCRANmirror() dernier choix (http mirrors) puis Lyon2

R> chooseCRANmirror()
R> install.packages('igraph')


  • Installation de Rstudio sur CentOS 6.7 en P0

La dernière version de Rstudio desktop ne fonctionne pas pour CentOS6.7 (nécessite des librairies plus récentes). Il faut donc télécharger et installer la version serveur :

# Dans un terminal, passer root (super-utilisateur)
bash> su
# puis les commandes ci-dessous (sans le "root>")
root> wget https://download2.rstudio.org/rstudio-server-rhel-0.99.892-x86_64.rpm
root> yum install --nogpgcheck rstudio-server-rhel-0.99.892-x86_64.rpm

Ensuite, on accède à l'interface avec le navigateur : http://localhost:8787 avec un compte de la machine (normalement le compte guest)