silico.biotoul.fr
 

Enseignements

From silico.biotoul.fr

(Difference between revisions)
Jump to: navigation, search
(Calendrier des présentations)
(Videos des Cours)
 
(304 intermediate revisions not shown)
Line 1: Line 1:
 +
<!-- = Contrôles terminaux en distanciel 2020 =
 +
 +
'''Bioinformatique pour la génomique M1 Bioinfo CT session 2 2 juillet 10h-12h30''' : [[Media:CT_session2_BG_M1Bioinfo_juillet_2020.docx|sujet CT Biooinformatique pour la Génomique]] -->
 +
= Licence 2 et 3 Biologie  =
= Licence 2 et 3 Biologie  =
-
=== Bioinformatique - 2B2M (EDSVB4IM), BCP (EDSVA4HM), BOPE (L2 EDSVC4MM, L3 ELSVC6JM) ===
+
=== Bioinformatique - Option L2-L3 2B2M-BCP-BOPE ===
-
===='''Emploi du temps 2018-19'''====
+
UE en option avec différents codes :
 +
* L2 2B2M : EDSVB4IM
 +
* L2 BCP : EDSVA4HM
 +
* L2 BOPE : EDSVC4MM
 +
* L3 BOPE : ELSVC6JM
 +
 
 +
* Moodle : [https://moodle.univ-tlse3.fr/course/view.php?id=2518 EDSVB4IM]
 +
 
 +
===='''Emploi du temps 2019-20'''====
Aussi disponible sur https://calendar.google.com/calendar/embed?src=lic.bioinfo%40gmail.com&ctz=Europe/Paris
Aussi disponible sur https://calendar.google.com/calendar/embed?src=lic.bioinfo%40gmail.com&ctz=Europe/Paris
Line 9: Line 21:
<iframe src="https://calendar.google.com/calendar/embed?showTitle=0&amp;showCalendars=0&amp;mode=AGENDA&amp;height=400&amp;wkst=2&amp;hl=fr&amp;bgcolor=%23FFFFFF&amp;src=lic.bioinfo%40gmail.com&amp;color=%232952A3&amp;ctz=Europe%2FParis" style="border-width:0" width="550" height="400" frameborder="0" scrolling="no"></iframe>
<iframe src="https://calendar.google.com/calendar/embed?showTitle=0&amp;showCalendars=0&amp;mode=AGENDA&amp;height=400&amp;wkst=2&amp;hl=fr&amp;bgcolor=%23FFFFFF&amp;src=lic.bioinfo%40gmail.com&amp;color=%232952A3&amp;ctz=Europe%2FParis" style="border-width:0" width="550" height="400" frameborder="0" scrolling="no"></iframe>
</html>
</html>
 +
 +
 +
 +
<big><big>'''Les groupes de TD et TP 2019-20 sont disponibles sur moodle : [https://moodle.univ-tlse3.fr/course/view.php?id=2518 https://moodle.univ-tlse3.fr/course/view.php?id=2518]'''</big></big>
 +
{| class="wikitable"
{| class="wikitable"
!colspan="4"|EDT L2-L3 2B2M-BCP-BOPE Bioinformatique
!colspan="4"|EDT L2-L3 2B2M-BCP-BOPE Bioinformatique
|-
|-
-
|                      || CM U4-211                                  || TD        ||  TP
+
|                      || CM                                                 || TD        ||  TP
|-
|-
-
| semaine 03 - 14.01  || 13h30-15h40 R. Barriot  Bioinfo générale           ||
+
| semaine 03 - 18/01  || 13h45-15h45 R. Barriot  Bioinfo générale (lien zoom sur moodle)<br/> 16h00-18h00 F. Delavoie Imagerie         
 +
||
 +
||
|-
|-
-
| semaine 04 - 21.01  || 13h30-15h40 F. Delavoie Imagerie                    ||          || 15h50-18h00 groupes BOPE & BCP en 4TP2-M6 & M7 <br/> 18h10-20h20 groupe 2B2M en 4TP2-M6
+
| semaine 04 - 25/01   
 +
||                    
 +
||           
 +
|| 13h45-15h05 groupe TP1a en U1-205 et TP1b en U1-206<br/>
 +
15h15-16h35 groupe TP2c en U1-205 et TP2d en U1-206<br/>
 +
16h45-18h05 groupe TP3e en U1-205 et TP3f en U1-206
|-
|-
-
| semaine 05 - 28.01  || 13h30-15h40 R. Barriot  Bases de Données            || 15h50-18h00 U2-114 & U2-118 ||
+
| semaine 05 - 01/02   || 13h45-15h45 R. Barriot  Bases de Données             
 +
|| 15h55-17h55 groupe TD1 et groupe TD2
 +
||
|-
|-
-
| semaine 06 - 04.02  ||                                                    ||          || 13h30-15h40 groupes GR.TP1&2 en 4TP2-M6 & M7 <br/> 15h50-18h00 groupe GR.TP3 en 4TP2-M6
+
| semaine 06 - 08/02  ||                                                     
 +
||           
 +
|| 13h45-15h05 groupe TP1a en 4TP2-M6 et TP1b en 4TP2-M7<br/>  
 +
15h15-16h35 groupe TP2c en 4TP2-M6 et TP2d en 4TP2-M7<br/>
 +
16h45-18h05 groupe TP3e en 4TP2-M6 et TP2f en 4TP2-M7
|-
|-
-
| semaine 07 - 11.02  || 13h30-15h40 M. Bonhomme                             ||          || 15h50-18h00 groupes GR.TP1&2 en 4TP2-M6 & M7 <br/> 18h10-20h20 groupe GR.TP3 en 4TP2-M6
+
| semaine 07 - 15/02  || 13h45-15h45 M. Bonhomme                                                  
 +
||           
 +
|| 15h55-17h55 2 groupes TP à 20 étudiant·e·s à distance<br/>18h05-20h05 1 groupe TP à 10 étudiant·e·s en présentiel en 4TP4-P15
 +
|-
 +
| semaine 08 - 22/02  ||                                                   
 +
||         
 +
||
 +
|-
 +
| semaine 09 - 01/03  || '''13h45-15h15 Contrôle avec report en 4A-Molliard & ESH 13h45-15h45 en 3A-G50''' <br/>
 +
17h00-19h00 CM Banques de données et services bioinformatiques en ligne
 +
||         
 +
||
|-  
|-  
-
| semaine 08 - 18.02   || '''13h30-15h30 Contrôle continu en 2A-Grignard'''                                            ||          ||  
+
| semaine 10 - 08/03   ||                                        
-
<!--|-
+
||           
-
| semaine 10 - 04.03  ||                                          ||          ||
+
|| 13h45-15h05 groupe TP1a en 4TP4-P1 et TP1b en 4TP4-P15<br/>
-
-->
+
15h15-16h35 groupe TP2c en 4TP4-P1 et TP2d en 4TP4-P15<br/>
 +
16h45-18h05 groupe TP3e en 4TP4-P1 et TP3f en 4TP4-P15
|-   
|-   
-
| semaine 10 - 04.03  || 13h30-15h40 G. Fichant SysBio                      ||           || 15h50-18h00 groupes GR.TP1&2 en 4TP2-M6 & M7 <br/> 18h10-20h20 groupe GR.TP3 en 4TP2-M6
+
| semaine 11 - 15/03  ||                  
 +
||
 +
||  
|-
|-
-
| semaine 11 - 11.03  ||                                            || 13h30-15h40 GR.TD1 en U2-114 <br/> 15h50-18h00 GR.TD2 en U2-114 ||  
+
| semaine 12 - 22/03  ||                                             
 +
|| 13h45-15h55 groupe TD1 <br/>  
 +
16h05-18h10 groupe TD2
 +
||  
|-
|-
-
| semaine 13 - 25.03  ||                                           ||          || 13h30-15h40 groupe GR.TP1 en 4TP4-P0 <br/> 15h50-18h00 groupe GR.TP2 en 4TP4-P0<br/> 18h10-20h20 groupe GR.TP3 en 4TP4-P0
+
| semaine 13 - 29/03  || '''13h45-15h15 Contrôle terminal anticipé  en 3A-Ampère et ESH 13h45-15h45 en 3A-G33''' 
 +
||         
 +
||
|-
|-
-
| semaine 15 - 08.04  || '''13h30-15h30 Contrôle terminal anticipé  en U1-Mathis''' ||          ||  
+
| semaine 14 - 05/04  ||
 +
||           
 +
||  
|-
|-
-
| semaine 26 - 25.06   || '''7h45-9h45 Contrôle terminal session 2 en U3-104''' ||          ||  
+
| semaine 15 - 12/04   ||                                                    
 +
||           
 +
||
|}
|}
 +
 +
 +
 +
 +
Line 74: Line 132:
* CM2 [[Media:LBioinfo.traitement.d.images.pdf|Traitement d'images]]
* CM2 [[Media:LBioinfo.traitement.d.images.pdf|Traitement d'images]]
* CM3 [[Media:LBioinfo.systemes.d.information.pdf|Introduction aux bases de données]]
* CM3 [[Media:LBioinfo.systemes.d.information.pdf|Introduction aux bases de données]]
-
* CM4 [[Media:LBioinfo_Genetics_bis.pdf|Utilisation de l'information génétique en biologie]]
+
* CM4 [[Media:L2_UE_Bioinfo_Genetics_2021.pdf|Utilisation de l'information génétique en biologie]]
-
* CM5 [[Media:Intro_BioSyst_L2_2019.pdf|Introduction à la biologie des système : initiation à la modélisation de réseaux de gènes]]
+
* CM5 [[Media:LBioinfo.bioseq.pdf|Introduction à la bioinformatique des séquences]]
 +
<!--
 +
* CM5 [[Media:Intro_BioSyst_L2_2019.pdf|Introduction à la biologie des système : initiation à la modélisation de réseaux de gènes]] -->
===='''Sujets de TD/TP'''====
===='''Sujets de TD/TP'''====
-
* [[L2-L3 Bioinfo - TP Traitement d'images|TP1]] Traitement d'images
+
* [[L2-L3 Bioinfo - TP Traitement d'images 1h20|TP1]] Traitement d'images
-
* [[L2-L3 Bioinfo - TD Bases de donnees - correction|TD1]] Bases de données
+
* [[L2-L3 Bioinfo - TD Bases de donnees|TD1]] Bases de données
* [[L2-L3 Bioinfo - TP Bases de donnees|TP2]] Bases de données
* [[L2-L3 Bioinfo - TP Bases de donnees|TP2]] Bases de données
-
* [[L2-L3 Bioinfo - TP Analyses statistiques des données (phénotypes,génotypes)|TP3]] Analyses statistiques des données (phénotypes,génotypes)
+
* [[L2-L3 Bioinfo - TP Analyses statistiques des données (phénotypes,génotypes)|TP3]] Analyses statistiques des données (phénotypes, génotypes)
* [[L2-L3 Bioinfo - TP Banques de données et analyse de séquences|TP4]] Banques de données et analyse de séquences
* [[L2-L3 Bioinfo - TP Banques de données et analyse de séquences|TP4]] Banques de données et analyse de séquences
* [[Media:L2-L3 Bioinfo - TD Transcriptomique.pdf|TD2]] Transcriptomique
* [[Media:L2-L3 Bioinfo - TD Transcriptomique.pdf|TD2]] Transcriptomique
Line 89: Line 149:
** [[Media:TP_regulation_fls2.pdf|correction du TP5 Modélisation d'un réseau de régulation]]
** [[Media:TP_regulation_fls2.pdf|correction du TP5 Modélisation d'un réseau de régulation]]
-
===='''Références'''====
+
= BioAnalyse L3 BCP =
-
* Petit cours d'autodéfense intellectuelle, Normand Baillargeon, 2006
+
-
=== BioAnalyse L3 BCP ===
+
==='''2020_2021 Planning des Enseignements L3 BCP et répartition en séries de TPs (semestre 6 (ELSV6CM1))'''===
 +
Toutes les informations relatives à l'UE de Bioanalyse sont également disponibles dans l'espace dédié sur Moodle
 +
* [[Media:2021-Planning_Bionalyse_L3 BCP_AVEC_salles_TP3.pdf|2021 Planning Bioanalyse L3 BCP (semaine rouge/bleue), mise a jour du Lundi 18 Janvier 21]]
 +
* [[Media:2021_GroupesTPs.pdf|2021 Séries de TP Bioanalyse (rouge/bleue) L3 BCP]]
 +
* [[Media:2021_Liens Zoom CMs Bioanalyse.pdf|2021 Liens Zoom pour CMs en distanciel de l'UE]]
 +
* [[Media:2021_Presentation de l'UE_OK_TP3.pdf|2021 Présentation de l'UE, mise à jour du Lundi 28 Janvier 21]]
-
==='''Planning des Enseignements L3 BCP semestre 6 (ELSV6CM1)'''===
+
<!--
-
 
+
* [[Media:1920_Bioanalyse_planning.pdf|Planning Bioanalyse L3 BCP 2019_2020]]
 +
* [[Media:presentation_UE_bioanalyse_2020.pdf|Présentation de l'UE]]
* [[Media:1819_Planning TPS CMs.pdf|Planning Bioanalyse L3 BCP 2018_2019]]
* [[Media:1819_Planning TPS CMs.pdf|Planning Bioanalyse L3 BCP 2018_2019]]
* [[Media:presentation_UE_bioanalyse_2019.pdf|Présentation de l'UE]]
* [[Media:presentation_UE_bioanalyse_2019.pdf|Présentation de l'UE]]
-
<!--
+
 
-->
-->
-
===='''Cours'''====
+
<!--===='''Vidéos des Cours'''====
-
* CM1 : [[Media:Introduction_bioinfo_2018.pdf|Introduction à la bioinformatique]]
+
* CM1 : [http://silico.biotoul.fr/enseignement/L3-Biologie/Videos_Cours_L3BCP_Bionalyse_2021/Introduction_Bioinfo.mp4 Introduction à la bioinformatique]
-
* CM2 : [[Media:banque_2017.pdf|Introduction aux banques de données]]
+
* CM1 : [[Media:Introduction_bioinfo_2020_modified.pdf|Introduction à la bioinformatique]]
 +
* CM2 : [[Media:banque_2020.pdf|Introduction aux banques de données]]
* CM3 : [[Media:Alignement_seq_nuc.pdf|Alignement de deux séquences d'acides nucléiques]]
* CM3 : [[Media:Alignement_seq_nuc.pdf|Alignement de deux séquences d'acides nucléiques]]
* CM4 : [[Media:Alignement_seq_prot_2015.pdf|Alignement de deux séquences protéiques : les matrices de substitution]]
* CM4 : [[Media:Alignement_seq_prot_2015.pdf|Alignement de deux séquences protéiques : les matrices de substitution]]
-
* CM5 : [[Media:Blast_2016.pdf|Recherche par similarité dans les bases de données]]
+
* CM5 : [[Media:Blast_2020.pdf|Recherche par similarité dans les bases de données]]
* CM6 : [[Media:AlignementMultiple_2017.pdf|Alignement multiple]]
* CM6 : [[Media:AlignementMultiple_2017.pdf|Alignement multiple]]
* CM6 : [[Media:motif_profil_2017.pdf|Motif et domaine fonctionnels]]
* CM6 : [[Media:motif_profil_2017.pdf|Motif et domaine fonctionnels]]
 +
-->
-
===='''TPs'''====
+
<!-- ===='''Videos des Cours'''====
 +
* CM1 : [http://silico.biotoul.fr/enseignement/L3-Biologie/Videos_Cours_L3BCP_Bionalyse_2021/Introduction_Bioinfo.mp4 Introduction à la bioinformatique]
 +
* CM2 : [http://silico.biotoul.fr/enseignement/L3-Biologie/Videos_Cours_L3BCP_Bionalyse_2021/bases_donnees.mp4 Introduction aux banques de données]
 +
* CM2 : [http://silico.biotoul.fr/enseignement/L3-Biologie/Videos_Cours_L3BCP_Bionalyse_2021/erratum_bases_donnees.mp4 petit erratum Introduction aux banques de données]
 +
* CM3 : [http://silico.biotoul.fr/enseignement/L3-Biologie/Videos_Cours_L3BCP_Bionalyse_2021/Comparaison_deux_sequences_partie1.mp4 Comparaison de deux séquences-partie_1]
 +
* CM4 : [http://silico.biotoul.fr/enseignement/L3-Biologie/Videos_Cours_L3BCP_Bionalyse_2021/comparaison_deux_sequences_partie2.mp4 Comparaison de deux séquences-partie_2]
 +
* CM5 : [http://silico.biotoul.fr/enseignement/L3-Biologie/Videos_Cours_L3BCP_Bionalyse_2021/recherche_similarite_avec_Blast.mp4 Recherche par similarité dans les bases de données]
 +
* CM5 : [http://silico.biotoul.fr/enseignement/L3-Biologie/Videos_Cours_L3BCP_Bionalyse_2021/Alignement_multiple.mp4 Alignement multiple]
 +
* CM6 : [http://silico.biotoul.fr/enseignement/L3-Biologie/Videos_Cours_L3BCP_Bionalyse_2021/Motifs_domaines_fonctionnels.mp4 Motifs et domaines fonctionnels] -->
 +
 
 +
===='''Cours'''====
 +
* CM1 : [[Media:Introduction_bioinfo_2020_modified.pdf|Introduction à la bioinformatique]]
 +
* CM2 : [[Media:banque_2020.pdf|Introduction aux banques de données]]
 +
* CM3 : [[Media:Alignement_seq_nuc.pdf|Alignement de deux séquences d'acides nucléiques]]
 +
* CM4 : [[Media:Alignement_seq_prot_2021.pdf|Alignement de deux séquences protéiques]]
 +
* CM5 : [[Media:Blast_2021.pdf|Recherche par similarité dans les bases de données]]
 +
* CM5 : [[Media:AlignementMultiple_2021.pdf|Alignement multiple]]
 +
* CM6 : [[Media:motif_profil_2021.pdf|Motifs et domaines fonctionnels]]
 +
 
 +
===='''TPs, année 2020_2021'''====
 +
 
 +
 
 +
* TP1 : [[TP1_Bioanalyse|Interrogation des banques de données et Analyses de Séquences]]
 +
* TP2 : [[TD2_Bioanalyse|Alignement par paires]]
 +
* TP3 : [[TD3_Bioanalyse21|Blast, Alignement multiple et Signatures]]
 +
 
 +
===='''TPs, versions antérieures à 2020_2021'''====
* TP1 : [[TD1_Bioanalyse|Interrogation des banques de données]]
* TP1 : [[TD1_Bioanalyse|Interrogation des banques de données]]
Line 119: Line 212:
* TP5 : [[TD5_Bioanalyse|Revisions]]
* TP5 : [[TD5_Bioanalyse|Revisions]]
-
===='''Exemples de contrôle continu corrigé'''====
+
===='''Annales & Corrigés'''====
 +
 
 +
* CT 2019 : [[Media:2019_CT_L3Bioanalyse_Corrigé_ETU.pdf|Questions + corrections]]
 +
* CC 2019 : [[Media:2019_CC_L3Bioanalyse_Corrigé_ETU.pdf|Questions + corrections]]
 +
* CC 2017 : [[Media:sujet_CC_Bioanalyse_L3BCP_2017_correction.pdf|Questions + corrections]]
* CC 2014 : [[Media:Correction_sujet_CC_L3Biologie_EL6BIOFM_2014.pdf|Questions + corrections]]
* CC 2014 : [[Media:Correction_sujet_CC_L3Biologie_EL6BIOFM_2014.pdf|Questions + corrections]]
* CC 2014 : [[Media:correction_alignement_CC_2013.pdf|correction de la construction de la matrice de programmation dynamique]]
* CC 2014 : [[Media:correction_alignement_CC_2013.pdf|correction de la construction de la matrice de programmation dynamique]]
-
<!-- * CC 2013 : [[Media:Correction_sujet_CC_L3Biologie_EL6BIOFM.pdf|Questions + corrections]]
+
* CC 2013 : [[Media:Correction_sujet_CC_L3Biologie_EL6BIOFM.pdf|Questions + corrections]]
-
* CC 2017 : [[Media:sujet_CC_Bioanalyse_L3BCP_2017_correction.pdf|Correction du contrôle continu 2017]] -->
+
-
=== BioAnalyse L3 2B2M ===
+
= BioAnalyse L3 2B2M =
===='''TPs'''====
===='''TPs'''====
Line 135: Line 231:
* TP5 : [[TD5_Bioanalyse|Revisions]]
* TP5 : [[TD5_Bioanalyse|Revisions]]
-
 
+
= Licence Pro GeBAP =
 +
=== Schéma de sélection et productions de semences ===
 +
* [[L3 GeBAP - TP Analyse de QTL|TP]] Analyse de QTL
= Licence 3 Biologie des Organismes des populations et Ecosystemes (BOPE)  =
= Licence 3 Biologie des Organismes des populations et Ecosystemes (BOPE)  =
Line 144: Line 242:
-->
-->
Initiation à la 'Bioanalyse'
Initiation à la 'Bioanalyse'
 +
* TP : [[TD1_Genome Selection Plantes|Interrogation des banques de données et recherche par similarité]]
-
* TP1 : [[TD1_Genome Selection Plantes|Interrogation des banques de données et recherche par similarité]]
+
<!--
* TP2 : [[TD2_Genome Selection Plantes|Alignement multiples et signatures proteiques]]
* TP2 : [[TD2_Genome Selection Plantes|Alignement multiples et signatures proteiques]]
-
<!--
+
 
==== Harmonisation des Connaissances, partie Bioanalyse (EMBIA1IM) ====
==== Harmonisation des Connaissances, partie Bioanalyse (EMBIA1IM) ====
* Supports de cours
* Supports de cours
Line 257: Line 356:
* [[M1 MABS TDB TD Transcriptome - Clustering|TD]] Transcriptome : clustering de profils d'expression
* [[M1 MABS TDB TD Transcriptome - Clustering|TD]] Transcriptome : clustering de profils d'expression
-->
-->
 +
 +
<!--
 +
<big>'''Contrôle continu'''</big>
<big>'''Contrôle continu'''</big>
-
* Contrôle continu 2018-19 : [[silico:enseignement/m1/tdb/CC2018/|Sujet et fichiers à utiliser]]
+
* Contrôle continu 2019-20 : [[silico:enseignement/m1/tdb/CC2019/|Sujet et fichiers à utiliser]]
-
<!--
+
<big>'''Contrôle continu'''</big>
 +
* Contrôle continu 2018-19 : [[silico:enseignement/m1/tdb/CC2018/|Sujet et fichiers à utiliser]]
 +
 
<big>'''Contrôle continu'''</big>
<big>'''Contrôle continu'''</big>
* Contrôle continu 2017-18 : [[silico:enseignement/m1/tdb/CC2017/|Sujet et fichiers à utiliser]]
* Contrôle continu 2017-18 : [[silico:enseignement/m1/tdb/CC2017/|Sujet et fichiers à utiliser]]
Line 286: Line 390:
** RStudio : https://www.rstudio.com
** RStudio : https://www.rstudio.com
** https://www.datacamp.com Apprendre R en ligne
** https://www.datacamp.com Apprendre R en ligne
 +
** https://rdrr.io/snippets/ Utilisation de R depuis un navigateur
 +
<!-- deprecated
** http://tryr.codeschool.com/levels/1/challenges/1 Apprendre en ligne aussi
** http://tryr.codeschool.com/levels/1/challenges/1 Apprendre en ligne aussi
** http://www.r-fiddle.org Utilisation de R depuis un navigateur
** http://www.r-fiddle.org Utilisation de R depuis un navigateur
 +
-->
==== Génétique Evolutive et Quantitative (EMBIA1GM) ====
==== Génétique Evolutive et Quantitative (EMBIA1GM) ====
Line 294: Line 401:
* [[Media: GEQ_intro.pdf|introduction à GEQ - M. Bonhomme]]
* [[Media: GEQ_intro.pdf|introduction à GEQ - M. Bonhomme]]
* [[Media: GEQ_pgen.pdf|GE - Génétique des populations - M. Bonhomme]]
* [[Media: GEQ_pgen.pdf|GE - Génétique des populations - M. Bonhomme]]
-
* [[Media: CM_Genetique_Quantitative_2018.pdf|GQ - Génétique-Quantitative - M. Bonhomme]]
+
* [[Media: CM_Genetique_Quantitative_2020bis.pdf|GQ - Génétique-Quantitative - M. Bonhomme]]
-
* [[Media: Carto_Marqueurs.pdf|GQ - Cartographie de marqueurs moléculaires - B. Mangin]]
+
* [[Media: Carto_Génétique_2019.pdf|GQ - Cartographie génétique - M. Bonhomme]]
-
* [[Media: Carto_QTL.pdf|GQ - Cartographie de Quantitative Tait Loci - B. Mangin]]
+
-
* [[Media: Asso-QTL.pdf|GQ - Génétique d'association - B. Mangin]]
+
'''Supports de TD/TP :'''
'''Supports de TD/TP :'''
* [[Media: TD1_GEQ_pgen.pdf|TD1 génétique des populations]]
* [[Media: TD1_GEQ_pgen.pdf|TD1 génétique des populations]]
-
* [[Media: TP1_genetic_diversity_drift.zip|TP1 génétique des populations]]
+
* [[Media: TP1_population_genetics_2020.zip|TP1 génétique des populations]]
-
* [[Media: TD-Génétique_Quantitative_2018.pdf|TD2 génétique quantitative]]
+
* [[Media: TD-Génétique_Quantitative_2019.pdf|TD2 génétique quantitative]]
-
* [[Media: TP_heritability.zip|TP2 génétique quantitative]]
+
* [[Media: TP2_heritability_2020.zip|TP2 génétique quantitative]]
-
* [[Media: TD-backcross.pdf|TD3 génétique quantitative liaison/association]]
+
* [[Media: TD3_carto_génétique_2019.pdf|TD3 cartographie génétique]]
-
* [[Media: TP2-measureLD.zip|TP3 génétique quantitative mesures DL]]
+
=== Master 1 - Bioinformatique et Biologie des Systèmes + Biotechnologies ===
=== Master 1 - Bioinformatique et Biologie des Systèmes + Biotechnologies ===
==== Evolution Moléculaire (EMBIA2EM) ====
==== Evolution Moléculaire (EMBIA2EM) ====
-
 
+
'''Emploi du temps :'''
 +
* [[Media:EDT_2021_UE_Evolution_Moleculaire_M1BI_M1BT.pdf|Emploi du temps UE Evolution moléculaire]]
'''Supports de cours :'''
'''Supports de cours :'''
-
* [[Media:CM1_EM_intro.pdf|Introduction à l'évolution moléculaire]]
+
* [[Media:cours_EM_intro_2021_updated.pdf|Introduction à l'évolution moléculaire]]
-
* [[Media:Phylogenie_Definitions_2019.pdf|Evolution moléculaire : définitions]]
+
* [[Media:Phylogenie_Definitions_2021.pdf|Evolution moléculaire : définitions]]
-
* [[Media:Phylogenie_Modeles_Evolutifs_2019.pdf|Modèles évolutifs]]
+
* [[Media:Phylogenie_Modeles_Evolutifs_2021.pdf|Modèles évolutifs]]
-
* [[Media:Phylogenie_Methodes_2019.pdf|Méthodes de reconstructions phylogénétiques ]]
+
* [[Media:Phylogenie_Methodes_2021.pdf|Méthodes de reconstructions phylogénétiques ]]
-
* [[Media:Phylogenie_Methodes_part2_2014.pdf|Méthodes de reconstructions phylogénétiques (suite)]]
+
* [[Media:Phylogenie_Methodes_part2_2021.pdf|Méthodes de reconstructions phylogénétiques (suite)]]
-
* [[Media:cours_EM_adapt_mol.pdf|Adaptation moléculaire]]
+
* [[Media:cours_EM_adapt_mol_2021_updated.pdf|Adaptation moléculaire]]  
 +
 
 +
<!-- '''Videos des Cours'''
 +
* CM1 : [http://silico.biotoul.fr/enseignement/m1-bioinfo/EvolMol/Introduction_phylogenie_moleculaire.mp4 Introduction phylogénie moléculaire - définitions- notions de base]
 +
* CM2 : [http://silico.biotoul.fr/enseignement/m1-bioinfo/EvolMol/Model_evolution_ac_nucl.mp4 Modèles d'évolution séquences d'acides nucléiques]
 +
* CM3 : [http://silico.biotoul.fr/enseignement/m1-bioinfo/EvolMol/Model_evolution_prot.mp4 Modèles d'évolution séquences protéiques]
 +
* CM4 : [http://silico.biotoul.fr/enseignement/m1-bioinfo/EvolMol/Methode_part1.mp4 Méthode de distance et méthode de maximum de parcimonie]
 +
* CM5 : [http://silico.biotoul.fr/enseignement/m1-bioinfo/EvolMol/Methods_part2_robustesse.mp4 Méthode de maximum de vraisemblance et robustesse des arbres] -->
'''Support TP : '''
'''Support TP : '''
* [[silico:enseignement/m1-mabs/EvolMol/TD1/index.html|tutorial TP1 et TP2]]
* [[silico:enseignement/m1-mabs/EvolMol/TD1/index.html|tutorial TP1 et TP2]]
-
* [[Media:Introduction_competence_2017.pdf|Petit topo d'introduction sur la régulation de la compétence chez ''S. pneumoniae'']]
+
* [[Media:Introduction_competence_2020.pdf|Petit topo d'introduction sur la régulation de la compétence chez ''S. pneumoniae'']]
-
* [[Media:Correction_TP1_TP2_2018.pdf|Correction des TP1 et TP2]]
+
**[[Media:Correction_TP1_TP2_2018.pdf|Correction des TP1 et TP2]]
 +
** [[silico:enseignement/m1-mabs/EvolMol/M1_EvolMol_Rstudio.tar.gz|Fichier Rstudio pour les TP1 et TP2]]
 +
** [[Media:SpneA01-NJ_tuto_muscle_Poisson.tree.ph | arbre COME NJ modèle Poisson]]
 +
** [[Media:SpneA01-NJ_tuto_muscle_Kimura.tree.ph | arbre COME NJ modèle Kimura]]
 +
** [[Media:SpneA01-PhyML_LG_tree.ph | arbre COME PhyML modèle LG]]
 +
** [[Media:SpneA01-PhyML_LG_empirical_tree.ph | arbre COME PhyML modèle LG fréquence des bases empiriques]]
 +
** [[Media:SpneA01.COMD_CleanUp_tuto_muscle.fst | alignement multiple COMD]]
 +
** [[Media:SpneA01-PhyML_ComD_LG_tree.ph | arbre COMD PhyML modèle LG]]
 +
** [[Media:SpneA01-PhyML_ComD_LG_empirical_tree.ph | arbre ComD PhyML modèle LG fréquence des bases empiriques]]
 +
 
 +
 
* [[Media:questions_reponses_ComD_ComE_trees_srep_2019.pdf|Questionnaire sur l'analyse des arbres ComE et ComD]]
* [[Media:questions_reponses_ComD_ComE_trees_srep_2019.pdf|Questionnaire sur l'analyse des arbres ComE et ComD]]
-
* [[Media:questions_reponses_ComD_ComE_trees_2019.pdf|Correction du questionnaire sur l'analyse des arbres ComE et ComD]]
+
** [[Media:questions_reponses_ComD_ComE_trees_2021.pdf|Correction du questionnaire sur l'analyse des arbres ComE et ComD]]
 +
 
 +
 
 +
* [[Media:TP3_adaptation_moleculaire_2021.zip|tutorial TP3]]
 +
* [[Media:TP3_adaptation_moleculaire_2019_2020.zip|tutorial TP3_2019_2020]]
-
* [[Media:TP3_adaptation_moleculaire.zip|tutorial TP3]]
 
'''Support TD : '''
'''Support TD : '''
Line 331: Line 456:
* [[Media:TD1_Evolution_Moleculaire.pdf|TD1 ]]
* [[Media:TD1_Evolution_Moleculaire.pdf|TD1 ]]
* [[Media:TD2_EMBAIE_M1_Bioinfo_M1_Biotech.pdf|TD2 exemple de Contrôle continu ]]
* [[Media:TD2_EMBAIE_M1_Bioinfo_M1_Biotech.pdf|TD2 exemple de Contrôle continu ]]
-
<!--* [[Media:Correction_TD2_Evolution_Moleculaire.pdf|Correction du TD2 ]] -->
+
** [[Media:Correction_TD2_Evolution_Moleculaire_2021.pdf|Correction du TD2 ]]
-
* [[Media:TD3 Evolution Moléculaire.pdf|TD3 Adaptation moléculaire ]]
+
* [[Media:TD3_Evolution Moléculaire_2021.pdf|TD3 Adaptation moléculaire ]]
-
'''Exemple CC corrigé : '''
+
<!--'''Exemple CC corrigé : '''
* [[Media:sujet_CC_complet.pdf|CC de 2011 ]]
* [[Media:sujet_CC_complet.pdf|CC de 2011 ]]
-
* [[Media:correction_CC_oct-2011.pdf|correction du CC de 2011 ]]
+
* [[Media:correction_CC_oct-2011.pdf|correction du CC de 2011 ]]-->
Line 351: Line 476:
=== Master 1 - Bioinformatique et Biologie des Systèmes ===
=== Master 1 - Bioinformatique et Biologie des Systèmes ===
 +
 +
* Diaporama réunion de rentrée [[Media:M1BBS.Accueil.Inscriptions.Pedagogiques.pdf]]
* [[Linux tips]]
* [[Linux tips]]
Line 357: Line 484:
==== Bioinformatique pour la Génomique (EMBIA1DM) ====
==== Bioinformatique pour la Génomique (EMBIA1DM) ====
'''Supports de cours :'''
'''Supports de cours :'''
 +
 +
* [[Media:Cours_Introduction_Jean_Phillipe_Galaud.pdf|Introduction génomique  (Jean-Philippe Galaud)]]
* [[Media:Introduction_bio_annotation_2018.pdf|Introduction biologique  (Gwennaele Fichant)]]
* [[Media:Introduction_bio_annotation_2018.pdf|Introduction biologique  (Gwennaele Fichant)]]
* [[Media:Annotation1.pdf|Annotation partie 1 (Gwennaele Fichant)]]
* [[Media:Annotation1.pdf|Annotation partie 1 (Gwennaele Fichant)]]
-
* [[Media:annotation2_2019.pdf|Annotation partie 2 (Gwennaele Fichant)]]
+
* [[Media:annotation2_2020.pdf|Annotation partie 2 (Gwennaele Fichant)]]
* [[Media:motif_profil_2017.pdf|Définition et identification des motifs et profils dans les séquences (cours de L3 Bioanalyse) (Gwennaele Fichant)]]
* [[Media:motif_profil_2017.pdf|Définition et identification des motifs et profils dans les séquences (cours de L3 Bioanalyse) (Gwennaele Fichant)]]
* [[Media:HMM_2017.pdf|Modèle de Markov Caché (HMM) (Gwennaele Fichant)]]  
* [[Media:HMM_2017.pdf|Modèle de Markov Caché (HMM) (Gwennaele Fichant)]]  
Line 379: Line 508:
'''Contrôle continu :'''  
'''Contrôle continu :'''  
-
*'''Rapport de TP''' sur le design d'un HMM à rendre au plus tard le '''lundi 22 octobre'''. M'envoyer par courrier le rapport en format pdf ainsi que le fichier en format texte comportant votre modèle avant estimation des probabilités.
+
*'''Rapport de TP''' sur le design d'un HMM à rendre au plus tard le '''lundi 12 octobre'''. M'envoyer par courrier le rapport en format pdf ainsi que le fichier en format texte comportant votre modèle avant estimation des probabilités et celui après estimation des probabilités.
-
* '''Projet annotation''' d'un fragment génomique à remettre au plus tard '''le vendredi 7 décembre'''  
+
* '''Projet annotation''' d'un fragment génomique à remettre au plus tard '''le lundi 7 décembre'''  
-
** '''Description du travail à réaliser dans le fichier ci-joint''' : [[Media:Projet.docx|description du projet]]
+
** '''Description du travail à réaliser dans le fichier ci-joint''' : [[Media:Projet_2019.docx|description du projet]]
-
** '''Description du travail à réaliser pour les parsers dans le fichier ci-joint''' : [[Media:Description_parsers.docx|description des parsers]]
+
** '''Description du travail à réaliser pour les parsers dans le fichier ci-joint''' : [[Media:Description_parsers_2019.docx|description des parsers]]
** '''Annoter une des deux séquences fournies''' : [[Media:seq1-5404.txt|séquence 1]] ou [[Media:seq2-7490.txt|séquence 2]]
** '''Annoter une des deux séquences fournies''' : [[Media:seq1-5404.txt|séquence 1]] ou [[Media:seq2-7490.txt|séquence 2]]
** [[Media:exemple_annotation_EMBL.txt|Exemple d'annotation au format EMBL]]
** [[Media:exemple_annotation_EMBL.txt|Exemple d'annotation au format EMBL]]
 +
<!--* [[silico:enseignement/m1-mabs/BGPG/|Cours et TP]]
<!--* [[silico:enseignement/m1-mabs/BGPG/|Cours et TP]]
* [[M1MABS BGPG Projets|Projets à remettre pour le '''17 mai''']]
* [[M1MABS BGPG Projets|Projets à remettre pour le '''17 mai''']]
Line 411: Line 541:
* [[M1 MABS BBS Math TD Proba|TD]] Probabilités
* [[M1 MABS BBS Math TD Proba|TD]] Probabilités
 +
<!--
 +
'''CCTP'''
 +
* Exam TP 2020-21 : [[silico:enseignement/m1/math/cc/|Sujet et fichiers à utiliser]]
<big>'''Exam TP'''</big>
<big>'''Exam TP'''</big>
* Exam TP 2018-19 : [[silico:enseignement/m1/math/cc/|Sujet et fichiers à utiliser]]
* Exam TP 2018-19 : [[silico:enseignement/m1/math/cc/|Sujet et fichiers à utiliser]]
 +
-->
'''Liens :'''
'''Liens :'''
Line 419: Line 553:
'''Références'''
'''Références'''
* ''Mathématiques pour les Sciences de la vie et de la Terre'' – C. David, S. Mustapha, F. Viens, N. Capron, edition Dunod
* ''Mathématiques pour les Sciences de la vie et de la Terre'' – C. David, S. Mustapha, F. Viens, N. Capron, edition Dunod
 +
 +
'''Projet 2020-21 :'''
 +
* [[silico:enseignement/m1/math/projet/M1BBS_Math_Sujet_Projet_2020-21.html|Sujet du projet 2020-21]]
 +
<!-- * Choix d'un graphe pour le projet (ne pas prendre un graphe déjà choisi par quelqu'un d'autre) : https://framadate.org/M1BBS-Projet-Math -->
 +
* Les projets sont à rendre '''avant''' les fêtes de fin d'année
 +
* Graphe à analyser
 +
*# [[silico:enseignement/m1/math/projet/g1.gr|graphe 1]] Gabryelle
 +
*# [[silico:enseignement/m1/math/projet/g2.gr|graphe 2]] Marine
 +
*# [[silico:enseignement/m1/math/projet/g3.gr|graphe 3]] Etienne
 +
*# [[silico:enseignement/m1/math/projet/g4.gr|graphe 4]] Hugo
 +
*# [[silico:enseignement/m1/math/projet/g5.gr|graphe 5]] Lou
 +
*# [[silico:enseignement/m1/math/projet/g6.gr|graphe 6]] Victoria
 +
*# [[silico:enseignement/m1/math/projet/g7.gr|graphe 7]] Julien
 +
*# [[silico:enseignement/m1/math/projet/g8.gr|graphe 8]] Antoine
 +
*# [[silico:enseignement/m1/math/projet/g9.gr|graphe 9]] Romane
 +
*# [[silico:enseignement/m1/math/projet/g10.gr|graphe 10]] Nadine
 +
*# [[silico:enseignement/m1/math/projet/g11.gr|graphe 11]] Wanxing
 +
*# [[silico:enseignement/m1/math/projet/g12.gr|graphe 12]] Oussama
 +
*# [[silico:enseignement/m1/math/projet/g13.gr|graphe 13]] Sandro
 +
*# [[silico:enseignement/m1/math/projet/g14.gr|graphe 14]] Mathias
 +
*# [[silico:enseignement/m1/math/projet/g15.gr|graphe 15]] Natacha
 +
*# [[silico:enseignement/m1/math/projet/g16.gr|graphe 16]] Nolan
 +
*# [[silico:enseignement/m1/math/projet/g17.gr|graphe 17]] Sophia
 +
*# [[silico:enseignement/m1/math/projet/g18.gr|graphe 18]] Ludovic
 +
*# [[silico:enseignement/m1/math/projet/g19.gr|graphe 19]] Maina
 +
*# [[silico:enseignement/m1/math/projet/g20.gr|graphe 20]] Jeanne
 +
*# [[silico:enseignement/m1/math/projet/g21.gr|graphe 21]]
 +
*# [[silico:enseignement/m1/math/projet/g22.gr|graphe 22]]
 +
*# [[silico:enseignement/m1/math/projet/g23.gr|graphe 23]]
 +
*# [[silico:enseignement/m1/math/projet/g24.gr|graphe 24]]
 +
 +
<!-- ARCHIVES
 +
'''Projet 2018-19:'''
'''Projet 2018-19:'''
Line 436: Line 603:
*# [[silico:enseignement/m1/math/projet/g10.gr|Groupe 10]]
*# [[silico:enseignement/m1/math/projet/g10.gr|Groupe 10]]
-
<!-- ARCHIVES
+
 
-
*# [[silico:enseignement/m1/math/projet/g11.gr|Groupe 11]]
+
-
*# [[silico:enseignement/m1/math/projet/g12.gr|Groupe 12]]
+
-
*# [[silico:enseignement/m1/math/projet/g13.gr|Groupe 13]]
+
*# [[silico:enseignement/m1/math/projet/Cleandb_Luca_2_A_1_1_65_Iso_Tr_1-CC1.gr|Groupe 1]]
*# [[silico:enseignement/m1/math/projet/Cleandb_Luca_2_A_1_1_65_Iso_Tr_1-CC1.gr|Groupe 1]]
Line 518: Line 682:
'''Supports de cours'''
'''Supports de cours'''
* [[Media:Traitement_de_graphes_et_reseaux_biologiques.pdf|Support de cours]]
* [[Media:Traitement_de_graphes_et_reseaux_biologiques.pdf|Support de cours]]
-
* [[Media:Traitement_des_graphes_et_reseaux_biologiques_communautes.pdf‎|Support de cours (communautés)]]
+
* [[Media:Traitement_des_graphes_et_reseaux_biologiques_communautes_v2019.pdf‎‎|Support de cours (communautés)]]
<!--
<!--
* [[Media:Traitement_des_graphes_et_reseaux_biologiques_communautes_v2013.pdf|Support de cours (communautés)]]
* [[Media:Traitement_des_graphes_et_reseaux_biologiques_communautes_v2013.pdf|Support de cours (communautés)]]
Line 524: Line 688:
-->
-->
'''Supports de TD/TP:'''  
'''Supports de TD/TP:'''  
 +
* [[Media:M1Bioinfo.Graphes.TD.definitions.pdf|TD1]] Définitions
* [[M1 BBS Graphes TP Visualisation|TP1]] Visualisation et exploration de graphes
* [[M1 BBS Graphes TP Visualisation|TP1]] Visualisation et exploration de graphes
-
* [[M1 BBS Graphes TP Librairie - Parcours de graphes|TP1-2-3-4]] Librairie et parcours de graphes
+
* [[M1 BBS Graphes TP Librairie - Parcours de graphes|TP1-2-3]] Librairie python et parcours de graphes
-
* [[M1 BBS Graphes TP Librairies R|TP4]] Librairies R
+
* [[M1 BBS Graphes TP Librairies R - igraph|TP4]] Librairies R - Prise en main igraph
* [[M1 BBS Graphes TP Recherche de communautés dans les graphes|TP5]] Recherche de communautés dans les graphes
* [[M1 BBS Graphes TP Recherche de communautés dans les graphes|TP5]] Recherche de communautés dans les graphes
-
* [[M1 BBS Graphes TP Dessin et Introduction iGraph|TP ancien]] Dessin de graphes et initiation à la librairie iGraph
+
* [[M1 BBS Graphes TP Dessin et Introduction iGraph|TP archivé]] Dessin de graphes et initiation à la librairie iGraph
-
<!--
+
 
-
'''Projets 2018-19'''
+
'''Projets 2020-21'''
* [[M1 BBS Graphes - Projets|Enoncé du projet]]
* [[M1 BBS Graphes - Projets|Enoncé du projet]]
-
-->
+
 
'''Liens:'''
'''Liens:'''
-
* [http://cytoscape.org/ Cytoscape] (et [http://cytoscapeweb.cytoscape.org/ Cytoscape Web] mais un peu dépassé maintenant)
+
Logiciels
 +
* [http://cytoscape.org/ Cytoscape] (et [https://js.cytoscape.org/ librairie pour l'analyse et la visualisaiton])
* [http://tulip.labri.fr/TulipDrupal/ Tulip] librairie C/C++ pour le traitement et la visualisation de graphes
* [http://tulip.labri.fr/TulipDrupal/ Tulip] librairie C/C++ pour le traitement et la visualisation de graphes
* [https://gephi.org/ Gephi]
* [https://gephi.org/ Gephi]
-
* [http://igraph.org/ igraph]
+
 
 +
Librairies
 +
* [http://igraph.org/ igraph] R, python, ...
 +
* [http://networkx.github.io NetworkX] python
 +
* [https://graph-tool.skewed.de graph-tool] python
 +
* [https://www.bioconductor.org/packages/release/bioc/html/STRINGdb.html Bioconductor/STRINGdb] interface STRINGdb et R igraph
 +
 
 +
Serveurs & Banques
* [http://bioinformatics.ai.sri.com/ptools/ Pathway tools]
* [http://bioinformatics.ai.sri.com/ptools/ Pathway tools]
-
* [http://deim.urv.cat/~sgomez/radatools.php Radatools]
 
* [http://www.metacyc.org/ METACYC]
* [http://www.metacyc.org/ METACYC]
* [http://string-db.org/ STRING]
* [http://string-db.org/ STRING]
-
* [https://www.bioconductor.org/packages/release/bioc/html/STRINGdb.html Bioconductor/STRINGdb] interface STRINGdb et R igraph
+
* [http://deim.urv.cat/~sgomez/radatools.php Radatools]
* [http://regulondb.ccg.unam.mx/ RegulonDb]
* [http://regulondb.ccg.unam.mx/ RegulonDb]
* [http://metanetx.org/ MetaNetX]
* [http://metanetx.org/ MetaNetX]
 +
 +
Formats
* Format GraphML http://graphml.graphdrawing.org/ et http://graphml.graphdrawing.org/primer/graphml-primer.html
* Format GraphML http://graphml.graphdrawing.org/ et http://graphml.graphdrawing.org/primer/graphml-primer.html
 +
 +
Autres
 +
* https://kateto.net/network-visualization Visu avec différents environnements et librairies
* Visualisation de l'algorithme Floyd-Warshall https://www.cs.usfca.edu/~galles/visualization/Floyd.html
* Visualisation de l'algorithme Floyd-Warshall https://www.cs.usfca.edu/~galles/visualization/Floyd.html
* [http://exercism.io exercism.io] : améliorer son niveau de programmation dans différents langages (notamment R)
* [http://exercism.io exercism.io] : améliorer son niveau de programmation dans différents langages (notamment R)
Line 586: Line 763:
==== Fouille de données (EMBIA2DM) ====
==== Fouille de données (EMBIA2DM) ====
-
<!--
+
 
-
{| class="wikitable"
+
-
!colspan="2"| Planning 2015-2016
+
-
|-
+
-
| date
+
-
| lieu
+
-
|-
+
-
|Jeudi 15 oct 10h-12h
+
-
| Einstein CM1 Intro
+
-
|-
+
-
|Jeudi 22 oct 10h-12h
+
-
| Einstein CM2 Classification 1
+
-
|-
+
-
|Jeudi 12 nov 10h-12h
+
-
| 1TP1-B08 CM3 Classification 2 (attention, changement de salle)
+
-
|-
+
-
|Jeudi 19 nov 10h-12h
+
-
| Einstein CM4 Clustering 1
+
-
|-
+
-
|Mercredi 25 nov 13h30-17h30
+
-
| 4TP4-P1 TP1 Classification (Knime, R ; Naive Bayes, Decision Tree, k-nn, X-validation)
+
-
|-
+
-
|Jeudi 26 nov 10h-12h
+
-
| Einstein CM5 Clustering 2
+
-
|-
+
-
|Mercredi 2 déc 13h30-17h30
+
-
| 4TP4-P1 TP2 Classification (R, python ; LDA, k-nn)
+
-
|-
+
-
|Jeudi 3 déc 10h-12h
+
-
| Einstein CM6 Règles d'associations
+
-
|-
+
-
|Mercredi 9 déc 13h30-17h30
+
-
| 4TP4-P1 TP3 Classification (python ; Naive Bayes)
+
-
|-
+
-
|Mercredi 16 déc 13h30-17h30
+
-
| 4TP4-P1 TP4 clustering
+
-
|-
+
-
|Jeudi 17 déc 10h-12h
+
-
| Einstein CM7 Règles d'associations
+
-
|}
+
-
-->
+
'''Support de cours:'''
'''Support de cours:'''
* [[Media:Data Mining - Intro.pdf|Introduction et Généralités]]
* [[Media:Data Mining - Intro.pdf|Introduction et Généralités]]
Line 639: Line 776:
<!-- * [[M1 MABS BBS Data Mining Projet|Enoncé]] du projet -->
<!-- * [[M1 MABS BBS Data Mining Projet|Enoncé]] du projet -->
* [[silico:enseignement/m1/datamining/projet/sujet.html|Sujet]]
* [[silico:enseignement/m1/datamining/projet/sujet.html|Sujet]]
 +
 +
'''Liens'''
'''Liens'''
Line 683: Line 822:
=== Master 2P Diagnostic moléculaire en microbiolgy ===
=== Master 2P Diagnostic moléculaire en microbiolgy ===
=====Supports de cours =====
=====Supports de cours =====
-
* [[Media:annotation1_M2Diag_2018.pdf|Annotation partie 1 (Gwennaele Fichant)]]
+
* [[Media:annotation2_M2Diag_2020.pdf|Annotation génomes bactériens (Gwennaele Fichant)]]
 +
<!-- * [[Media:Phylogenie_Definitions_2018_M2Diag.pdf|Définitions en phylogénie (Gwennaele Fichant)]] -->
 +
* [[Media:Introduction_Phylogenie_2019_M2Diag.pdf|Introduction à la reconstruction phylogénétique (Gwennaele Fichant)]]
 +
<!--* [[Media:annotation1_M2Diag_2018.pdf|Annotation partie 1 (Gwennaele Fichant)]]
* [[Media:annotation2_M2Diag_2018.pdf|Annotation partie 2 (Gwennaele Fichant)]]
* [[Media:annotation2_M2Diag_2018.pdf|Annotation partie 2 (Gwennaele Fichant)]]
-
* [[Media:Blast_2016.pdf|Recherche par similarité dans les bases de données (cours de L3 Bioanalyse)]]
+
* [[Media:Blast_2016.pdf|Recherche par similarité dans les bases de données (cours de L3 Bioanalyse)]]-->
=====Tutoriels de TP=====
=====Tutoriels de TP=====
-
*[[silico:enseignement/m1-bioinfo/BG/TD_annotation/tutorial_annotation_new_NVU.html|Annotation d'un fragment génomique bactérien]]
+
*[[silico:enseignement/m1-bioinfo/BG/TD_annotation/Tutorial_annotation_v1_2019.html|Annotation d'un fragment génomique bactérien]]
* [[silico:enseignement/m1-mabs/EvolMol/TD1/index.html|Analyse évolutive de la cascade de régulation de la compétence chez les Streptocoques]]
* [[silico:enseignement/m1-mabs/EvolMol/TD1/index.html|Analyse évolutive de la cascade de régulation de la compétence chez les Streptocoques]]
Line 703: Line 845:
-->
-->
===== Atelier système =====
===== Atelier système =====
-
* [[M2BBS - Atelier Système]]  
+
* [[M2BBS - Atelier Système]]
-
===== UE Communication =====
+
==== Atelier Chipseq ====
 +
**[[silico:enseignement/m2BBS/ChipSeq/TP_CHIPSEQ_2019_M2Bioinfo_FolderEtudiants.tar.gz|données TP]]
 +
 
 +
====Atelier Galaxy ====
 +
 
 +
* http://genoweb.toulouse.inra.fr/~formation/8_Galaxy_Admin/2019/
 +
 
 +
==== UE Communication ====
=====liste des publications à présenter en préparation des ateliers:=====
=====liste des publications à présenter en préparation des ateliers:=====
-
'''Chaque publication sera choisie par deux étudiant(e)s. La présentation de la publication est personnelle. Donc chaque personne préparera une présentation powerpoint (ou pdf), diapositives en anglais, de 15 minutes qui sera suivie de 10 minutes de questions. La présentation et les questions se feront en français. Attention, ne pas oublier de consulter et de récupérer les supplementary data. La présentation devra faire ressortir la problématique abordée (question posée et contexte), la démarche bioinformatique adoptée, les résultats sous forme synthétisée avec choix pertinent des figures pour illustrer votre propos et la conclusion/discussion.
+
'''Chaque publication sera choisie par deux étudiant(e)s. La présentation de la publication est personnelle. Donc chaque personne préparera une présentation powerpoint (ou pdf), diapositives en anglais, de 15 minutes qui sera suivie de 10 minutes de questions. La présentation et les questions se feront en français. Attention, ne pas oublier de récupérer et de lire les supplementary data qui sont aussi important pour la compréhension de l'article. La présentation devra faire ressortir la problématique abordée (question posée et contexte), la démarche bioinformatique adoptée, les résultats sous forme synthétisée avec choix pertinent des figures pour illustrer votre propos et la conclusion/discussion.
'''
'''
* '''Atelier Métabolomique'''
* '''Atelier Métabolomique'''
** Article 1 :
** Article 1 :
-
*** [[Media:Frezza2011.pdf|Haem oxygenase is synthetically lethal with the tumour suppressor fumarate hydratase]]
+
*** [[Media:Cell_2020.pdf|A Deep Learning Approach to Antibiotic Discovery]]
 +
*** [[Media:Cell_2020_supdata.zip |Supplementary information]]
 +
** Article 1 :
 +
*** [[Media:Nature_com_2018.pdf|Pan-cancer analysis of transcriptional metabolic dysregulation using The Cancer Genome Atlas]]
 +
*** Supplementary information à récupérer sur https://www.nature.com/articles/s41467-018-07232-8#additional-information
* '''Atelier ChipSeq'''
* '''Atelier ChipSeq'''
Line 725: Line 878:
* '''Atelier Phylogénomique'''
* '''Atelier Phylogénomique'''
** Article 1 :  
** Article 1 :  
-
*** [[Media:Thakur_Guttman_2016.pdf| A De-Novo Genome Analysis Pipeline (DeNoGAP) for large-scale comparative prokaryotic genomics studies]]
+
*** [[Media:ecceTERA.pdf| ecceTERA: comprehensive gene tree-species tree reconciliation using parsimony]]
-
*** Supplementary information à récupérer sur  https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-016-1142-2
+
*** [[Media:ecceTERA_Supplementary_Data.zip| Supplementary information à lire impérativement]]
** Article 2
** Article 2
***[[Media:Ali_et_al_2019.pdf|Identifying Clusters of High Confidence Homologies in Multiple Sequence Alignments]]
***[[Media:Ali_et_al_2019.pdf|Identifying Clusters of High Confidence Homologies in Multiple Sequence Alignments]]
Line 738: Line 891:
*** Supplementary information à récupérer sur https://journals.plos.org/ploscompbiol/article?id=10.1371/journal.pcbi.0040009
*** Supplementary information à récupérer sur https://journals.plos.org/ploscompbiol/article?id=10.1371/journal.pcbi.0040009
-
 
+
===== Calendrier des présentations d'articles =====
-
===== Calendrier des présentations =====
+
{| class="wikitable"
{| class="wikitable"
-
!colspan="5"|EDT présentation des articles (les noms sont donnés pour rappel mais ordre de passage indifférent sauf Fulya 1ère)
+
!colspan="5"|EDT présentation des articles (les noms sont donnés pour rappel mais ordre de passage indifférent)
|-
|-
-
|lundi 23 septembre 9h30-11h30 :
+
|lundi 28 septembre 9h30-12h :
-
|articles Atelier Métabolomique
+
|articles Atelier Phylogénomique
-
|article 1 : 9H30-11h00 (Juliette, Matthieu, Marine)
+
|article 1 : 9H30-10h30 (Codé, Laura D)
-
||Commentaires : 11h-11h30
+
|article 2 : 10h40-11h40 (Laura B, Tomas)
 +
||Commentaires : 11h40-12h
|-
|-
-
|lundi 23 septembre 13h30-16h :
+
|lundi 28 septembre 13h45-16h15 :
|articles Atelier Modélisation  
|articles Atelier Modélisation  
-
|article 1 : 13H30-14h30 (Alex, Soufiane)
+
|article 1 : 13H45-14h45 (Alexia, Aurélien)
-
|article 2 : 14h30-15h30 (Eve, Clara)
+
|article 2 : 14h55-15h55 (Pierre, Safia)
-
|Commentaires : 15h30-16h
+
|Commentaires : 15h55-16h15
|-
|-
-
|mardi 24 septembre 9h30-12h :  
+
|mardi 29 septembre 9h30-12h :  
-
|article Atelier Phylogénomique
+
|article Atelier Métabolomique
-
|article 2 : 9H30-10h30 (Tristan, Geoffrey)
+
|article 1 : 9H30-10h30 (Baptiste, Quentin)
-
|article 1 : 10H30-11h30 (Elise, Chloé)
+
|article 2 : 10H40-11h40 (Antoine, Sophie)
-
|Commentaires : 11h30-12h
+
|Commentaires : 11h40-12h
|-
|-
-
|mardi 24 septembre 14h-16h30 :
+
|mardi 28 septembre 13h45-16h15 :
|articles Atelier ChipSeq
|articles Atelier ChipSeq
-
|article 1 : 14h-15h (Marion, Julien)
+
|article 1 : 13h45-14h45 (Jérémy, Valentine)
-
|article 2 : 15h-16h (Nicolas, Cheryn)
+
|article 2 : 14h55-15h55 (Houyem, Refka)
-
|Commentaires : 16h-16h30
+
|Commentaires : 15h55-16h15
|}
|}
-
===== Intégration de Données Hétérogènes - Partie R. Barriot =====
+
==== Intégration de Données Hétérogènes - Partie R. Barriot ====
* [[Media:M2BBS - Integration de Donnees Heterogenes - Generalites.pdf|Approches]]
* [[Media:M2BBS - Integration de Donnees Heterogenes - Generalites.pdf|Approches]]
Line 776: Line 929:
* [[M2BBS Integration de Donnes Heterogenes - Projets|Projets IDH]]
* [[M2BBS Integration de Donnes Heterogenes - Projets|Projets IDH]]
-
===== Atelier Génétique Satistique - S. Boitard =====
+
<!--
 +
==== Atelier Génétique Satistique - S. Boitard ====
Support de cours et TD:
Support de cours et TD:
* [[Media:coal_cours.pdf|Coalescence : principe et bases théoriques]] '''
* [[Media:coal_cours.pdf|Coalescence : principe et bases théoriques]] '''
* [[Media:coal_td.pdf|TD de génétique des populations]] '''
* [[Media:coal_td.pdf|TD de génétique des populations]] '''
 +
* [[Media:tp_struc.pdf|TP : Diversité génétique d’une population structurée]] '''
* [[Media:Mol_Biol_Evol-1999-Pritchard-1791-8.pdf|article : investigation de l'histoire démographique du chromosome Y par analyse des loci microsatellite]] '''
* [[Media:Mol_Biol_Evol-1999-Pritchard-1791-8.pdf|article : investigation de l'histoire démographique du chromosome Y par analyse des loci microsatellite]] '''
* [[Media:cours_tp_hapFLK.pdf|cours et TP de détection de locus sous sélection positive]] '''
* [[Media:cours_tp_hapFLK.pdf|cours et TP de détection de locus sous sélection positive]] '''
Line 787: Line 942:
*[[silico:enseignement/m2BBS/Genet_Stat/tp_coal.html|TP : simulations de données génétiques par coalescence fichier format html]]
*[[silico:enseignement/m2BBS/Genet_Stat/tp_coal.html|TP : simulations de données génétiques par coalescence fichier format html]]
*[[Media:tp_abc.pdf|TP estimation de paramètres par une approche ABC]] '''
*[[Media:tp_abc.pdf|TP estimation de paramètres par une approche ABC]] '''
-
*[[https://github.com/willyrv/BioInfoCours]] autres documents
+
*[[https://github.com/willyrv/BioInfoCours]] autres documents  
 +
-->
-
=====Atelier Phylogénomique=====
+
====Atelier Phylogénomique====
-
Intervenants : Hélène Chiapello, Kathy.De-Sousa, Claire Hoede et Yves Quentin
+
Intervenants : Claire Hoede et Yves Quentin
[http://silico.biotoul.fr/p/Atelier_Phylog%C3%A9nomique Atelier de Phylogénomique]
[http://silico.biotoul.fr/p/Atelier_Phylog%C3%A9nomique Atelier de Phylogénomique]
 +
<!--
===== Biologie des Systèmes - R. Barriot =====
===== Biologie des Systèmes - R. Barriot =====
* [[Media:GRNs.pdf|Réseaux de régulation]] '''
* [[Media:GRNs.pdf|Réseaux de régulation]] '''
* [[M2 BBS TP GRNs]]
* [[M2 BBS TP GRNs]]
 +
-->
-
 
+
==== Biologie des Systèmes - G. Czaplicki ====
-
===== Biologie des Systèmes - G. Czaplicki =====
+
* [[Media:document_GC.pdf|Support de cours]] '''
* [[Media:document_GC.pdf|Support de cours]] '''
Line 810: Line 967:
* [[Media:compet.dat|compet.dat]] '''
* [[Media:compet.dat|compet.dat]] '''
-
===== Biologie des Systèmes - G. Fichant =====
+
==== Biologie des Systèmes - G. Fichant ====
Support de cours:
Support de cours:
* [[Media:Intro_BioSyst_2017.pdf|Introduction to system biology]] '''
* [[Media:Intro_BioSyst_2017.pdf|Introduction to system biology]] '''
-
* [[Media:SCAN_rappel_enzymo.pdf|Petit rappel enzymologie partie 1 ]]'''
+
* [[Media:Rappel_enzymo_v1.pdf|Petit rappel enzymologie]]'''
-
* [[Media:Rappel_enzymo_v1.pdf|Petit rappel enzymologie partie 2 ]]'''
+
* [[Media:SCAN_rappel_enzymo.pdf|Complément rappel enzymologie]]'''
-
<!--* [[Media:network_motifs.pdf|Two and three nodes network motifs in transcriptional networks]]'''-->
+
* [[Media:Petri_net_2020.pdf|Introduction to Petri net models]]'''
-
* [[Media:Petri_net_2018.pdf|Introduction to Petri net models]]'''
+
* [[Media:Modele_stochastique.pdf|Introduction to stochastic simulation]]'''
* [[Media:Modele_stochastique.pdf|Introduction to stochastic simulation]]'''
-
* [[Media:parameter_estimation_2017.pdf|parameter estimation]]'''
+
* [[Media:parameter_estimation_2019.pdf|Introduction parameter estimation]]'''
-
* [[Media:Intro_PL_2015.pdf|Introduction to Piece-wise linear differential equation models]]'''
+
* [[Media:Intro_PL_2020.pdf|Introduction to Piece-wise linear differential equation models]]'''
* [[Media:Model_analysis.pdf| System dynamic analyses ]]'''
* [[Media:Model_analysis.pdf| System dynamic analyses ]]'''
 +
* [[Media:SBML.pdf| Bref introduction au standard SBML ]]'''
 +
 +
<!--* [[Media:network_motifs.pdf|Two and three nodes network motifs in transcriptional networks]]'''-->
<!-- * [[Media:parameter_estimation.pdf| Parameter estimation (M. Weyder)]]''' -->
<!-- * [[Media:parameter_estimation.pdf| Parameter estimation (M. Weyder)]]''' -->
Line 826: Line 985:
'''TP :'''
'''TP :'''
* [[Media:CopasiUserguide-20100803-1.pdf|Copasi user guide]]
* [[Media:CopasiUserguide-20100803-1.pdf|Copasi user guide]]
 +
* [[Media:Aide_Copasi.pdf|mnémo pour prise en main de Copasi plus simulation avec R]]
 +
* Lien vers le site de Snoopy : https://www-dssz.informatik.tu-cottbus.de/DSSZ/Software/Snoopy
 +
*'''TP1 : modeling of the psp response when cell envelop  is damaged'''
*'''TP1 : modeling of the psp response when cell envelop  is damaged'''
-
** [[Media:Toni_et_al_2011.pdf|article support]]
+
** [[Media:TP_psp_response.pdf|Short description the biological process]]
-
** [[Media:constante_stochastic_2017-18.png|constantes stochastiques]]
+
<!--** [[Media:Modele_psp_extended_PN.xpn|Modèle corrigé du réseau qualitatif]] -->
-
** [[Media:psp_system_dm.txt|membrane data]]
+
** [[Media:Modele_psp_save_essai_2019_modif_constante.spn|Modèle corrigé du réseau stochastique]]
 +
 
 +
<!-- ** [[Media:constante_stochastic_2017-18.png|constantes stochastiques]]
 +
<!--** [[Media:Toni_et_al_2011.pdf|article support]] -->
 +
<!--** [[Media:constante_stochastic_2017-18.png|constantes stochastiques]] -->
 +
<!-- ** [[Media:modele_psp_save_2017-18.spn|Modèle stochastique corrigé]] -->
 +
<!--** [[Media:psp_system_dm.txt|membrane data]]
** [[Media:psp_system_hBCA.txt|hBCA data]]
** [[Media:psp_system_hBCA.txt|hBCA data]]
** [[Media:psp_system_olg.txt|olg data]]
** [[Media:psp_system_olg.txt|olg data]]
** [[Media:psp_system_hBCAF.txt|hBCAF data]]
** [[Media:psp_system_hBCAF.txt|hBCAF data]]
-
** [[Media:psp_system_hBcCcA.txt|hBcAcCc data]]
+
** [[Media:psp_system_hBcCcA.txt|hBcAcCc data]]-->
 +
 
*'''TP2 : modeling of the repressilator:'''
*'''TP2 : modeling of the repressilator:'''
-
** [[Media:tp_repressilator_2018.pdf|Short description of the repressilator regulation]]
+
** [[Media:tp_repressilator_2019.pdf|Short description of the repressilator regulation]]
** [[Media:repressilator_continu_2018_time_serie_500.csv|protein time series data]]
** [[Media:repressilator_continu_2018_time_serie_500.csv|protein time series data]]
 +
** [[Media:repressilator_stochastique_2019.spn|Modèle corrigé du réseau stochastique]]
 +
** [[Media:repressilator_continu_2020.cpn|Modèle corrigé du réseau continu avec Snoopy]]
 +
 +
<!-- ** [[Media:repressilator_prot.cps|Modèle corrigé Copasi]] -->
 +
<!-- ** [[Media:repressilator.Rmd|script R pour intégration ODE]]-->
 +
<!-- ** [[Media:constante_stochastique.png|stochastic constant file]]
<!-- ** [[Media:constante_stochastique.png|stochastic constant file]]
** [[Media:constante_continu.png|ODE parameter file]] -->
** [[Media:constante_continu.png|ODE parameter file]] -->
 +
*'''TP3 : modeling phosphate regulation in enterobacteria:'''
*'''TP3 : modeling phosphate regulation in enterobacteria:'''
** [[Media:TP_phosphate_new_2018.pdf|Short biological description of the phosphate regulation]]
** [[Media:TP_phosphate_new_2018.pdf|Short biological description of the phosphate regulation]]
 +
** [[Media:Modele_stochastique_switch.spn|Modèle corrigé du réseau stochastique]]
 +
<!--** [[Media:PN_extended_phosphate.xpn| Modèle corrigé du réseau qualitatif]]-->
 +
 +
<!-- ** [[Media:PN_extended_phosphate.xpn|Modèle "extended Petri Net" corrigé]]-->
 +
<!-- ** [[Media:modele_stochastique_switch.spn|Modèle stochastique corrigé]]-->
 +
-
*'''TP4 : modeling of the regulation of lactose operon :'''
+
'''TP4 : modeling of the regulation of lactose operon : CR à rendre avant 20h le 11/12/2020'''
-
** [[Media:operon_lactose_description_2018.pdf|Short biological description of the lactose operon regulation]]
+
** [[Media:operon_lactose_description_2018.pdf|'''TP à rendre''' Short biological description of the lactose operon regulation]]
-
** [[Media:operon_lac_2018_last.spn|Modèle stochastique corrigé]]
+
** [[Media:operon_lac_2018_last.spn|'''Modèle stochastique corrigé''']]
 +
** [[Media:res_stochastique_lactose_3pics.PNG|'''Capture écran lactose input''']]
 +
** [[Media:res_stochastique_prot_3pics.PNG| '''Capture écran comportement des protéines''']]
<!-- ** [[Media:constantes_2017.txt|stochastic constant file]]
<!-- ** [[Media:constantes_2017.txt|stochastic constant file]]
** [[Media:Constante_parameter_lactose_stochastique_2017.PNG|screen shot of the constant definition in the model]]-->
** [[Media:Constante_parameter_lactose_stochastique_2017.PNG|screen shot of the constant definition in the model]]-->
Line 859: Line 1,043:
* [[M2R_BV|Clonage in silico_pDRAW]]
* [[M2R_BV|Clonage in silico_pDRAW]]
 +
 +
<!--
<!--
 +
 +
-------------------------------------------------------
 +
'''Examen 2020-2021'''
 +
 +
 +
'''Partie E. Gaulin'''
 +
 +
Veuillez trouver ci-dessous, la séquence fasta de l'ADNc PEP2 du champignon que l'on souhaite cloner dans le vecteur de destination pCAMBIA
 +
 +
'''>ADNc_PEP2'''
 +
 +
ACTTCCAAATTCTAGTATATGTAATCCTTTT
 +
GTTCGGGTTCATGATCGAATTCCAAAGAGTGGAAAACAAGCAAAAGGTTAAATATACATG
 +
CCATTTTTGGAGCTTTCGAGCTCATAACACAGGTGAGCGCGACGAATGGATCCCTCGCTA
 +
ATAACATCATGGTCGTGGGCGCCGTCCTTGCGGCGCTCGTCGCCGGCGGGTCGTGCGGGC
 +
CCCCGAAGGTGCCACCCGGCCCCAACATCACCACCAACTACAACGGCAAGTGGCTCACCG
 +
CTAGGGCCACCTGGTACGGTCAGCCCAACGGTGCCGGCGCTCCTGACAACGGCGGTGCGT
 +
GCGGGATCAAGAACGTGAACCTGCCACCCTACAGCGGCATGACGGCGTGCGGCAACGTCC
 +
CCATCTTCAAGGACGGCAAGGGCTGCGGCTCATGCTACGAGGTGAGATGCAAGGAAAAAC
 +
CTGAGTGCTCGGGCAATCCAGTCACGGTGTACATCACTGACATGAACTACGAACCTATCG
 +
CTCCCTACCACTTCGACTTGAGCGGCAAGGCCTTCGGCTCCCTGGCAAAGCCCGGGCTCA
 +
ACGACAAGATTCGCCACTGCGGCATCATGGACGTCGAGTTCAGAAGGGTGCGATGCAAGT
 +
ACCCCGCCGGGCAGAAGATCGTGTTCCACATCGAGAAGGGCTGCAACCCCAACTACCTGG
 +
CCGTGCTGGTGAAGTATGTGGCGGACGACGGCGACATCGTGCTGATGGAAATCCAGGACA
 +
AGTTGTCGGCTGAGTGGAAGCCCATGAAGCTCTCTTGGGGCGCCATCTGGAGGATGGACA
 +
CTGCCAAGGCGCTCAAGGGCCCCTTCTCCATCCGCCTCACCAGCGAGTCCGGCAAGAAGG
 +
TCATCGCCAAAGACGTCATCCCGGCGAACTGGAGACCCGATGCCGTCTACACTTCCAACG
 +
TCCAATTTTACGTAACTTTGAATTCCCTTCGATTCATCCGGCACAGCGGGCTATGGACCT
 +
TCAGCAGCAAGCTAATTAAGTTGGCAGCATGCACCGCTAACCTTATATACTACTGAGACT
 +
TCCAAATTCTAGTATATGTAATCCTTTTGTTCGGGTTCATGATCGAATTCCAAAGAGTGG
 +
AAAACAAGCAAAAGGTTAAATATACATGCCATTTTTGGAAGCTTGGCTTTCGAGGGTACC
 +
CCTGATAGTT
 +
 +
 +
'''Partie C. Mathé'''
 +
* [http://genoweb.toulouse.inra.fr/~mathe/M2RBV/Exam_Blast.htm Lien vers un BLAST sauvegardé]
 +
 +
 +
'''Partie C. Albenne'''
 +
 +
*[[Media:EXPB1b.doc|EXPB1]]
 +
*[[Media:2hcz.dsv|Structure]]
 +
 +
 +
-------------------------------------------
 +
 +
'''Examen 2018-2019'''
'''Examen 2018-2019'''

Current revision as of 07:45, 6 July 2021


Contents

Licence 2 et 3 Biologie

Bioinformatique - Option L2-L3 2B2M-BCP-BOPE

UE en option avec différents codes :

  • L2 2B2M : EDSVB4IM
  • L2 BCP : EDSVA4HM
  • L2 BOPE : EDSVC4MM
  • L3 BOPE : ELSVC6JM

Emploi du temps 2019-20

Aussi disponible sur https://calendar.google.com/calendar/embed?src=lic.bioinfo%40gmail.com&ctz=Europe/Paris


Les groupes de TD et TP 2019-20 sont disponibles sur moodle : https://moodle.univ-tlse3.fr/course/view.php?id=2518


EDT L2-L3 2B2M-BCP-BOPE Bioinformatique
CM TD TP
semaine 03 - 18/01 13h45-15h45 R. Barriot Bioinfo générale (lien zoom sur moodle)
16h00-18h00 F. Delavoie Imagerie
semaine 04 - 25/01 13h45-15h05 groupe TP1a en U1-205 et TP1b en U1-206

15h15-16h35 groupe TP2c en U1-205 et TP2d en U1-206
16h45-18h05 groupe TP3e en U1-205 et TP3f en U1-206

semaine 05 - 01/02 13h45-15h45 R. Barriot Bases de Données 15h55-17h55 groupe TD1 et groupe TD2
semaine 06 - 08/02 13h45-15h05 groupe TP1a en 4TP2-M6 et TP1b en 4TP2-M7

15h15-16h35 groupe TP2c en 4TP2-M6 et TP2d en 4TP2-M7
16h45-18h05 groupe TP3e en 4TP2-M6 et TP2f en 4TP2-M7

semaine 07 - 15/02 13h45-15h45 M. Bonhomme 15h55-17h55 2 groupes TP à 20 étudiant·e·s à distance
18h05-20h05 1 groupe TP à 10 étudiant·e·s en présentiel en 4TP4-P15
semaine 08 - 22/02
semaine 09 - 01/03 13h45-15h15 Contrôle avec report en 4A-Molliard & ESH 13h45-15h45 en 3A-G50

17h00-19h00 CM Banques de données et services bioinformatiques en ligne

semaine 10 - 08/03 13h45-15h05 groupe TP1a en 4TP4-P1 et TP1b en 4TP4-P15

15h15-16h35 groupe TP2c en 4TP4-P1 et TP2d en 4TP4-P15
16h45-18h05 groupe TP3e en 4TP4-P1 et TP3f en 4TP4-P15

semaine 11 - 15/03
semaine 12 - 22/03 13h45-15h55 groupe TD1

16h05-18h10 groupe TD2

semaine 13 - 29/03 13h45-15h15 Contrôle terminal anticipé en 3A-Ampère et ESH 13h45-15h45 en 3A-G33
semaine 14 - 05/04
semaine 15 - 12/04





Supports de cours

Sujets de TD/TP

BioAnalyse L3 BCP

2020_2021 Planning des Enseignements L3 BCP et répartition en séries de TPs (semestre 6 (ELSV6CM1))

Toutes les informations relatives à l'UE de Bioanalyse sont également disponibles dans l'espace dédié sur Moodle



Cours

TPs, année 2020_2021

TPs, versions antérieures à 2020_2021

Annales & Corrigés

BioAnalyse L3 2B2M

TPs

Licence Pro GeBAP

Schéma de sélection et productions de semences

  • TP Analyse de QTL

Licence 3 Biologie des Organismes des populations et Ecosystemes (BOPE)

Du génome à la sélection des plantes (ELSVC5EM)

Initiation à la 'Bioanalyse'


Master

Master 1

Master 1 - Bioinformatique et Biologie des Systèmes + Biologie Végétale ADAM

Génomique Evolutive et Phylogénie

Supports de TD/TP :

Medicago SNPs sequences
Drosophile sequences
Primates lysozymes sequences

Traitement de données biologiques (EMBIA1FM)

Supports de cours :

Supports de TD/TP :


Liens

Génétique Evolutive et Quantitative (EMBIA1GM)

Support de cours:

Supports de TD/TP :

Master 1 - Bioinformatique et Biologie des Systèmes + Biotechnologies

Evolution Moléculaire (EMBIA2EM)

Emploi du temps :

Supports de cours :


Support TP :




Support TD :



Master 1 - Bioinformatique et Biologie des Systèmes


Bioinformatique pour la Génomique (EMBIA1DM)

Supports de cours :

Tutoriels de TP :

Aide pour la réalisation du projet annotation

Contrôle continu :

  • Rapport de TP sur le design d'un HMM à rendre au plus tard le lundi 12 octobre. M'envoyer par courrier le rapport en format pdf ainsi que le fichier en format texte comportant votre modèle avant estimation des probabilités et celui après estimation des probabilités.


Mathématique pour la Biologie (EMBIA1EM)

Sujets de TP :

  • TD Calcul matriciel
  • TD ACP
  • TD Modélisation
  • TD Probabilités


Liens :

  • http://exercism.io : améliorer son niveau de programmation dans différents langages (notamment R)

Références

  • Mathématiques pour les Sciences de la vie et de la Terre – C. David, S. Mustapha, F. Viens, N. Capron, edition Dunod

Projet 2020-21 :





Traitement de graphes et réseaux biologiques (EMBIA1KM)

Supports de cours

Supports de TD/TP:

  • TD1 Définitions
  • TP1 Visualisation et exploration de graphes
  • TP1-2-3 Librairie python et parcours de graphes
  • TP4 Librairies R - Prise en main igraph
  • TP5 Recherche de communautés dans les graphes
  • TP archivé Dessin de graphes et initiation à la librairie iGraph


Projets 2020-21


Liens: Logiciels

Librairies

Serveurs & Banques

Formats

Autres

Références

  • Introduction to Algorithms, Corsen, Leiserson and Rivest, MIT Press and McGraw-Hill
  • Detection of Functional Modules From Protein Interaction Networks, Pereira-Leal, Enright and Ozounis, PROTEINS: Structure, Function, and Bioinformatics, 49-57, 2004.
  • An efficient algorithm for large-scale detection of protein families, Enright, Van Dongen and Ozounis, Nucleic Acids Research, 1575-84, 2002 PMID:11917018
  • Kavosh: a new algorithm for finding network motifs, Kashani et al., BMC Bioinformatics, 2009. DOI:10.1186/1471-2105-10-318
  • Pathway discovery in metabolic networks by subgraph extraction, Faust et al., Bioinformatics, 1211-1218, 2010. DOI:10.1093/bioinformatics/btq105


Fouille de données (EMBIA2DM)

Support de cours:

Sujets de TD/TP

  • TD Classification, validation croisée et clustering

Projet


Liens

Références

  • Data Mining: Concepts and Techniques, J. Han and M. Kamber, 2006.
  • GENECODIS: a web-based tool for finding significant concurrent annotations in gene lists, Carmona-Saez et al., Genome Biology, 2007.
  • Petit cours d'autodéfense intellectuelle, Normand Baillargeon, 2006

Master 1 - MEEF

Sciences de la Vie (EE7BSVFM)

Supports de TD :


Master 2

Master 2P Diagnostic moléculaire en microbiolgy

Supports de cours
Tutoriels de TP

Master 2 - Bioinformatique et Biologie des Systèmes

Atelier système

Atelier Chipseq

Atelier Galaxy

UE Communication

liste des publications à présenter en préparation des ateliers:

Chaque publication sera choisie par deux étudiant(e)s. La présentation de la publication est personnelle. Donc chaque personne préparera une présentation powerpoint (ou pdf), diapositives en anglais, de 15 minutes qui sera suivie de 10 minutes de questions. La présentation et les questions se feront en français. Attention, ne pas oublier de récupérer et de lire les supplementary data qui sont aussi important pour la compréhension de l'article. La présentation devra faire ressortir la problématique abordée (question posée et contexte), la démarche bioinformatique adoptée, les résultats sous forme synthétisée avec choix pertinent des figures pour illustrer votre propos et la conclusion/discussion.

Calendrier des présentations d'articles
EDT présentation des articles (les noms sont donnés pour rappel mais ordre de passage indifférent)
lundi 28 septembre 9h30-12h : articles Atelier Phylogénomique article 1 : 9H30-10h30 (Codé, Laura D) article 2 : 10h40-11h40 (Laura B, Tomas) Commentaires : 11h40-12h
lundi 28 septembre 13h45-16h15 : articles Atelier Modélisation article 1 : 13H45-14h45 (Alexia, Aurélien) article 2 : 14h55-15h55 (Pierre, Safia) Commentaires : 15h55-16h15
mardi 29 septembre 9h30-12h : article Atelier Métabolomique article 1 : 9H30-10h30 (Baptiste, Quentin) article 2 : 10H40-11h40 (Antoine, Sophie) Commentaires : 11h40-12h
mardi 28 septembre 13h45-16h15 : articles Atelier ChipSeq article 1 : 13h45-14h45 (Jérémy, Valentine) article 2 : 14h55-15h55 (Houyem, Refka) Commentaires : 15h55-16h15

Intégration de Données Hétérogènes - Partie R. Barriot


Atelier Phylogénomique

Intervenants : Claire Hoede et Yves Quentin

Atelier de Phylogénomique


Biologie des Systèmes - G. Czaplicki

Fichiers avec les codes :

Biologie des Systèmes - G. Fichant

Support de cours:


TP :






TP4 : modeling of the regulation of lactose operon : CR à rendre avant 20h le 11/12/2020

Master 2 - ADAM (Adaptation, Développement et Amélioration des plantes en présence de Microorganismes)

Biologie Computationnelle

Documents, partie E. Gaulin


Culture

  • Une histoire de tout ou presque... Bill Bryson, Payot, coll. "Petite Bibliothèque Payot" n° 851, 2012 (ISBN: 9782228907576)
  • Norman Baillargeon - Petit cours d'autodéfense intellectuelle, Éditions Lux, collection Instinct de Liberté, 2005. (ISBN: 2-895960-44-5)
  • Faire l'économie de la haine, Alain Deneault, 2018, Ecosociete Eds, coll. Polemos
  • Comment tout peut s'effondrer. Petit manuel de collapsologie à l'usage des générations présentes. 2015. Pablo Servigne, :Raphaël Stevens. seuil
  • Les sentiers de l'utopie, I. Fremeaux et J. Jordan, 2012.

F.A.Q.

  • Installation de igraph sur CentOS 6.7 en P0

Sous R, l'installation d'igraph échoue avec le protocole https, il faut donc choisir un mirroir avec le protocol http : choseCRANmirror() dernier choix (http mirrors) puis Lyon2

R> chooseCRANmirror()
R> install.packages('igraph')


  • Installation de Rstudio sur CentOS 6.7 en P0

La dernière version de Rstudio desktop ne fonctionne pas pour CentOS6.7 (nécessite des librairies plus récentes). Il faut donc télécharger et installer la version serveur :

# Dans un terminal, passer root (super-utilisateur)
bash> su
# puis les commandes ci-dessous (sans le "root>")
root> wget https://download2.rstudio.org/rstudio-server-rhel-0.99.892-x86_64.rpm
root> yum install --nogpgcheck rstudio-server-rhel-0.99.892-x86_64.rpm

Ensuite, on accède à l'interface avec le navigateur : http://localhost:8787 avec un compte de la machine (normalement le compte guest)