Enseignements
From silico.biotoul.fr
m (→Mathématique pour la Biologie (EMBIA1EM)) |
m (→Mathématique pour la Biologie (EMBIA1EM)) |
||
Line 451: | Line 451: | ||
'''Projet 2020-21 :''' | '''Projet 2020-21 :''' | ||
* [[silico:enseignement/m1/math/projet/M1BBS_Math_Sujet_Projet_2020-21.html|Sujet du projet 2020-21]] | * [[silico:enseignement/m1/math/projet/M1BBS_Math_Sujet_Projet_2020-21.html|Sujet du projet 2020-21]] | ||
- | * Choix d'un graphe pour le projet (ne pas prendre un graphe déjà choisi par quelqu'un d'autre) : https://framadate.org/M1BBS-Projet-Math | + | <!-- * Choix d'un graphe pour le projet (ne pas prendre un graphe déjà choisi par quelqu'un d'autre) : https://framadate.org/M1BBS-Projet-Math --> |
* Les projets sont à rendre '''avant''' les fêtes de fin d'année | * Les projets sont à rendre '''avant''' les fêtes de fin d'année | ||
* Graphe à analyser | * Graphe à analyser | ||
- | *# [[silico:enseignement/m1/math/projet/g1.gr|graphe 1]] | + | *# [[silico:enseignement/m1/math/projet/g1.gr|graphe 1]] Gabryelle |
- | *# [[silico:enseignement/m1/math/projet/g2.gr|graphe 2]] | + | *# [[silico:enseignement/m1/math/projet/g2.gr|graphe 2]] Marine |
- | *# [[silico:enseignement/m1/math/projet/g3.gr|graphe 3]] | + | *# [[silico:enseignement/m1/math/projet/g3.gr|graphe 3]] Etienne |
- | *# [[silico:enseignement/m1/math/projet/g4.gr|graphe 4]] | + | *# [[silico:enseignement/m1/math/projet/g4.gr|graphe 4]] Hugo |
- | *# [[silico:enseignement/m1/math/projet/g5.gr|graphe 5]] | + | *# [[silico:enseignement/m1/math/projet/g5.gr|graphe 5]] Lou |
- | *# [[silico:enseignement/m1/math/projet/g6.gr|graphe 6]] | + | *# [[silico:enseignement/m1/math/projet/g6.gr|graphe 6]] Victoria |
- | *# [[silico:enseignement/m1/math/projet/g7.gr|graphe 7]] | + | *# [[silico:enseignement/m1/math/projet/g7.gr|graphe 7]] Nadine |
- | *# [[silico:enseignement/m1/math/projet/g8.gr|graphe 8]] | + | *# [[silico:enseignement/m1/math/projet/g8.gr|graphe 8]] Antoine |
- | *# [[silico:enseignement/m1/math/projet/g9.gr|graphe 9]] | + | *# [[silico:enseignement/m1/math/projet/g9.gr|graphe 9]] Romane |
- | *# [[silico:enseignement/m1/math/projet/g10.gr|graphe 10]] | + | *# [[silico:enseignement/m1/math/projet/g10.gr|graphe 10]] Julien |
- | *# [[silico:enseignement/m1/math/projet/g11.gr|graphe 11]] | + | *# [[silico:enseignement/m1/math/projet/g11.gr|graphe 11]] Wanxing |
- | *# [[silico:enseignement/m1/math/projet/g12.gr|graphe 12]] | + | *# [[silico:enseignement/m1/math/projet/g12.gr|graphe 12]] Oussama |
- | *# [[silico:enseignement/m1/math/projet/g13.gr|graphe 13]] | + | *# [[silico:enseignement/m1/math/projet/g13.gr|graphe 13]] Sandro |
- | *# [[silico:enseignement/m1/math/projet/g14.gr|graphe 14]] | + | *# [[silico:enseignement/m1/math/projet/g14.gr|graphe 14]] Mathias |
- | *# [[silico:enseignement/m1/math/projet/g15.gr|graphe 15]] | + | *# [[silico:enseignement/m1/math/projet/g15.gr|graphe 15]] Natacha |
- | *# [[silico:enseignement/m1/math/projet/g16.gr|graphe 16]] | + | *# [[silico:enseignement/m1/math/projet/g16.gr|graphe 16]] Nolan |
- | *# [[silico:enseignement/m1/math/projet/g17.gr|graphe 17]] | + | *# [[silico:enseignement/m1/math/projet/g17.gr|graphe 17]] Sophia |
- | *# [[silico:enseignement/m1/math/projet/g18.gr|graphe 18]] | + | *# [[silico:enseignement/m1/math/projet/g18.gr|graphe 18]] Ludovic |
- | *# [[silico:enseignement/m1/math/projet/g19.gr|graphe 19]] | + | *# [[silico:enseignement/m1/math/projet/g19.gr|graphe 19]] Maina |
- | *# [[silico:enseignement/m1/math/projet/g20.gr|graphe 20]] | + | *# [[silico:enseignement/m1/math/projet/g20.gr|graphe 20]] Jeanne |
*# [[silico:enseignement/m1/math/projet/g21.gr|graphe 21]] | *# [[silico:enseignement/m1/math/projet/g21.gr|graphe 21]] | ||
*# [[silico:enseignement/m1/math/projet/g22.gr|graphe 22]] | *# [[silico:enseignement/m1/math/projet/g22.gr|graphe 22]] |
Revision as of 08:56, 19 October 2020
Licence 2 et 3 Biologie
Bioinformatique - Option L2-L3 2B2M-BCP-BOPE
UE en option avec différents codes :
- L2 2B2M : EDSVB4IM
- L2 BCP : EDSVA4HM
- L2 BOPE : EDSVC4MM
- L3 BOPE : ELSVC6JM
- Moodle : EDSVB4IM
Emploi du temps 2019-20
Aussi disponible sur https://calendar.google.com/calendar/embed?src=lic.bioinfo%40gmail.com&ctz=Europe/Paris
Les groupes de TD et TP 2019-20 sont disponibles sur moodle : https://moodle.univ-tlse3.fr/course/view.php?id=2518
EDT L2-L3 2B2M-BCP-BOPE Bioinformatique | |||
---|---|---|---|
CM 3TP2-Einstein | TD | TP | |
semaine 04 - 20/01 | 13h30-15h40 R. Barriot Bioinfo générale | ||
semaine 05 - 27/01 | 13h30-15h40 F. Delavoie Imagerie | 15h50-18h00 groupes gTP1 en 4TP4-P1 & gTP2 en 4TP4-P15 18h10-20h20 groupe gTP3 en 4TP2-M6 | |
semaine 06 - 03/02 | 13h30-15h40 R. Barriot Bases de Données | 15h50-18h00 U2-116 groupe gTD1 18h10-20h20 U2-116 groupe gTD2 | |
semaine 07 - 10/02 | 13h30-15h40 groupe gTP1 en 4TP2-M7 15h50-18h00 groupe gTP2 en 4TP4-P15 18h10-20h20 groupe gTP3 en 4TP2-M6 | ||
semaine 08 - 17/02 | |||
semaine 09 - 24/02 | 13h30-15h40 M. Bonhomme | 15h50-18h00 groupes gTP1 en 4TP4-P1 & gTP2 en 4TP4-P15 18h10-20h20 groupe gTP3 en 4TP2-M6 | |
semaine 10 - 02/03 | 13h30-15h30 Contrôle continu en 4A-Leclerc | ||
semaine 11 - 09/03 | 13h30-15h40 G. Fichant SysBio | 15h50-18h00 groupes gTP1 en 4TP4-P1 & gTP2 en 4TP4-P15 18h10-20h20 groupe gTP3 en 4TP2-M6 | |
semaine 12 - 16/03 | 13h30-15h40 gTD1 en U2-220 15h50-18h00 gTD2 en U2-219 | ||
semaine 13 - 23/03 | 13h30-15h40 groupe gTP1 en 4TP2-M7 15h50-18h00 groupe gTP2 en 4TP4-P15 18h10-20h20 groupe gTP3 en 4TP2-M6 | ||
semaine 14 - 30/03 | 13h30-15h30 Contrôle terminal anticipé en Eintein |
Supports de cours
- CM1 Introduction à la bioinformatique
- CM2 Traitement d'images
- CM3 Introduction aux bases de données
- CM4 Utilisation de l'information génétique en biologie
- CM5 Introduction à la biologie des système : initiation à la modélisation de réseaux de gènes
Sujets de TD/TP
- TP1 Traitement d'images
- TD1 Bases de données
- TP2 Bases de données
- TP3 Analyses statistiques des données (phénotypes,génotypes)
- TP4 Banques de données et analyse de séquences
- TD2 Transcriptomique
- TP5 Modélisation d'un réseau de régulation
BioAnalyse L3 BCP
Planning des Enseignements L3 BCP semestre 6 (ELSV6CM1)
Cours
- CM1 : Introduction à la bioinformatique
- CM2 : Introduction aux banques de données
- CM3 : Alignement de deux séquences d'acides nucléiques
- CM4 : Alignement de deux séquences protéiques : les matrices de substitution
- CM5 : Recherche par similarité dans les bases de données
- CM6 : Alignement multiple
- CM6 : Motif et domaine fonctionnels
TPs
- TP1 : Interrogation des banques de données
- TP2 : Alignement par paires
- TP3 : Analyse de séquences et biologie Moléculaire
- TP4 : BLAST, alignement multiple, signature protéique
- TP5 : Revisions
Exemples de contrôle continu corrigé
- CC 2014 : Questions + corrections
- CC 2014 : correction de la construction de la matrice de programmation dynamique
BioAnalyse L3 2B2M
TPs
- TP1 : Interrogation des banques de données
- TP2 : Alignement par paires
- TP3 : Analyse de séquences et biologie Moléculaire
- TP4 : BLAST, alignement multiple, signature protéique
- TP5 : Revisions
Licence 3 Biologie des Organismes des populations et Ecosystemes (BOPE)
Du génome à la sélection des plantes (ELSVC5EM)
Initiation à la 'Bioanalyse'
Master
Master 1
Master 1 - Bioinformatique et Biologie des Systèmes + Biologie Végétale ADAM
Génomique Evolutive et Phylogénie
Supports de TD/TP :
- TP Adaptation Moleculaire
- Données pour le TP:
Medicago SNPs sequences Drosophile sequences Primates lysozymes sequences
Traitement de données biologiques (EMBIA1FM)
Supports de cours :
Supports de TD/TP :
- TP1 - Introduction à R
- TP2 - Régression linéaire, probabilités, intervalles de confiance
- TP3 - Tests statistiques - 1
- TP4 - Tests statistiques - 2 (ANOVA)
- TP5 - Analyse de transcriptome
- Archives
- Contrôle continu de 2011 avec son corrigé CC 2011 et correction.zip
Liens
- Documentation
- Aide mémoire des commandes R
- Aide mémoire pour RMarkdown disponible depuis http://rmarkdown.rstudio.com et http://rmarkdown.rstudio.com/lesson-1.html
- RMarkdown un peu plus détaillé disponible aussi sur la page citée à la ligne précédente
- http://www.rdocumentation.org/ Toute l'aide des librairies R (avec recherche)
- Sites dédiés
- Site de R : http://www.r-project.org et sites miroirs (dont ceux en France) pour télécharger le logiciel et les librairies : https://cran.r-project.org/mirrors.html
- RStudio : https://www.rstudio.com
- https://www.datacamp.com Apprendre R en ligne
- https://rdrr.io/snippets/ Utilisation de R depuis un navigateur
Génétique Evolutive et Quantitative (EMBIA1GM)
Support de cours:
- présentation de GEQ - M. Bonhomme
- introduction à GEQ - M. Bonhomme
- GE - Génétique des populations - M. Bonhomme
- GQ - Génétique-Quantitative - M. Bonhomme
- GQ - Cartographie génétique - M. Bonhomme
Supports de TD/TP :
- TD1 génétique des populations
- TP1 génétique des populations
- TD2 génétique quantitative
- TP2 génétique quantitative
- TD3 cartographie génétique
Master 1 - Bioinformatique et Biologie des Systèmes + Biotechnologies
Evolution Moléculaire (EMBIA2EM)
Supports de cours :
- Introduction à l'évolution moléculaire
- Evolution moléculaire : définitions
- Modèles évolutifs
- Méthodes de reconstructions phylogénétiques
- Méthodes de reconstructions phylogénétiques (suite)
- Adaptation moléculaire
Support TP :
- tutorial TP1 et TP2
- Petit topo d'introduction sur la régulation de la compétence chez S. pneumoniae
- Correction des TP1 et TP2
- Questionnaire sur l'analyse des arbres ComE et ComD
- Correction du questionnaire sur l'analyse des arbres ComE et ComD
Support TD :
Exemple CC corrigé :
Master 1 - Bioinformatique et Biologie des Systèmes
- Diaporama réunion de rentrée Media:M1BBS.Accueil.Inscriptions.Pedagogiques.pdf
Bioinformatique pour la Génomique (EMBIA1DM)
Supports de cours :
- Introduction génomique (Jean-Philippe Galaud)
- Introduction biologique (Gwennaele Fichant)
- Annotation partie 1 (Gwennaele Fichant)
- Annotation partie 2 (Gwennaele Fichant)
- Définition et identification des motifs et profils dans les séquences (cours de L3 Bioanalyse) (Gwennaele Fichant)
- Modèle de Markov Caché (HMM) (Gwennaele Fichant)
- Introduction aux alignements de génomes bactériens (Gwennaele Fichant)
Tutoriels de TP :
- Annotation d'un fragment génomique bactérien
- design d'un HMM pour prédire les promoteurs sigma A de B. subtilis
Aide pour la réalisation du projet annotation
Contrôle continu :
- Rapport de TP sur le design d'un HMM à rendre au plus tard le lundi 12 octobre. M'envoyer par courrier le rapport en format pdf ainsi que le fichier en format texte comportant votre modèle avant estimation des probabilités et celui après estimation des probabilités.
- Projet annotation d'un fragment génomique à remettre au plus tard le lundi 7 décembre
- Description du travail à réaliser dans le fichier ci-joint : description du projet
- Description du travail à réaliser pour les parsers dans le fichier ci-joint : description des parsers
- Annoter une des deux séquences fournies : séquence 1 ou séquence 2
- Exemple d'annotation au format EMBL
Mathématique pour la Biologie (EMBIA1EM)
Sujets de TP :
Liens :
- http://exercism.io : améliorer son niveau de programmation dans différents langages (notamment R)
Références
- Mathématiques pour les Sciences de la vie et de la Terre – C. David, S. Mustapha, F. Viens, N. Capron, edition Dunod
Projet 2020-21 :
- Sujet du projet 2020-21
- Les projets sont à rendre avant les fêtes de fin d'année
- Graphe à analyser
- graphe 1 Gabryelle
- graphe 2 Marine
- graphe 3 Etienne
- graphe 4 Hugo
- graphe 5 Lou
- graphe 6 Victoria
- graphe 7 Nadine
- graphe 8 Antoine
- graphe 9 Romane
- graphe 10 Julien
- graphe 11 Wanxing
- graphe 12 Oussama
- graphe 13 Sandro
- graphe 14 Mathias
- graphe 15 Natacha
- graphe 16 Nolan
- graphe 17 Sophia
- graphe 18 Ludovic
- graphe 19 Maina
- graphe 20 Jeanne
- graphe 21
- graphe 22
- graphe 23
- graphe 24
Traitement de graphes et réseaux biologiques (EMBIA1KM)
Supports de cours
Supports de TD/TP:
- TP1 Visualisation et exploration de graphes
- TP1-2-3-4 Librairie et parcours de graphes
- TP4 Librairies R
- TP5 Recherche de communautés dans les graphes
- TP archivé Dessin de graphes et initiation à la librairie iGraph
Projets 2019-20
Liens:
Logiciels
- Cytoscape (et Cytoscape Web mais un peu dépassé maintenant)
- Tulip librairie C/C++ pour le traitement et la visualisation de graphes
- Gephi
Librairies
- igraph R, python, ...
- NetworkX python
- graph-tool python
- Bioconductor/STRINGdb interface STRINGdb et R igraph
Serveurs & Banques
Formats
- Format GraphML http://graphml.graphdrawing.org/ et http://graphml.graphdrawing.org/primer/graphml-primer.html
Autres
- https://kateto.net/network-visualization Visu avec différents environnements et librairies
- Visualisation de l'algorithme Floyd-Warshall https://www.cs.usfca.edu/~galles/visualization/Floyd.html
- exercism.io : améliorer son niveau de programmation dans différents langages (notamment R)
- rosalind : apprentissage python en bioinformatique
Références
- Introduction to Algorithms, Corsen, Leiserson and Rivest, MIT Press and McGraw-Hill
- Detection of Functional Modules From Protein Interaction Networks, Pereira-Leal, Enright and Ozounis, PROTEINS: Structure, Function, and Bioinformatics, 49-57, 2004.
- An efficient algorithm for large-scale detection of protein families, Enright, Van Dongen and Ozounis, Nucleic Acids Research, 1575-84, 2002 PMID:11917018
- Kavosh: a new algorithm for finding network motifs, Kashani et al., BMC Bioinformatics, 2009. DOI:10.1186/1471-2105-10-318
- Pathway discovery in metabolic networks by subgraph extraction, Faust et al., Bioinformatics, 1211-1218, 2010. DOI:10.1093/bioinformatics/btq105
Fouille de données (EMBIA2DM)
Support de cours:
- Introduction et Généralités
- Classification, prédiction et caractérisation
- Clustering
- Règles d'association
Sujets de TD/TP
- TD Classification, validation croisée et clustering
Projet
Liens
- Data mining map
- http://www.kdnuggets.com/
- UCI KDD Archive (datasets)
- mloss (machine learning open source software) http://mloss.org
- Librairies et logiciels
- RapidMiner
- Knime
- weka
- Orange librairie python
- scikit-learn une autre librairie python
- Sequential Pattern Mining Framework open source Java implementation
Références
- Data Mining: Concepts and Techniques, J. Han and M. Kamber, 2006.
- GENECODIS: a web-based tool for finding significant concurrent annotations in gene lists, Carmona-Saez et al., Genome Biology, 2007.
- Petit cours d'autodéfense intellectuelle, Normand Baillargeon, 2006
Master 1 - MEEF
Sciences de la Vie (EE7BSVFM)
Supports de TD :
Master 2
Master 2P Diagnostic moléculaire en microbiolgy
Supports de cours
- Annotation génomes bactériens (Gwennaele Fichant)
- Introduction à la reconstruction phylogénétique (Gwennaele Fichant)
Tutoriels de TP
- Analyse évolutive de la cascade de régulation de la compétence chez les Streptocoques
- Petit topo d'introduction sur la régulation de la compétence chez S. pneumoniae
Master 2 - Bioinformatique et Biologie des Systèmes
Atelier système
Atelier Chipseq
Atelier Galaxy
UE Communication
liste des publications à présenter en préparation des ateliers:
Chaque publication sera choisie par deux étudiant(e)s. La présentation de la publication est personnelle. Donc chaque personne préparera une présentation powerpoint (ou pdf), diapositives en anglais, de 15 minutes qui sera suivie de 10 minutes de questions. La présentation et les questions se feront en français. Attention, ne pas oublier de récupérer et de lire les supplementary data qui sont aussi important pour la compréhension de l'article. La présentation devra faire ressortir la problématique abordée (question posée et contexte), la démarche bioinformatique adoptée, les résultats sous forme synthétisée avec choix pertinent des figures pour illustrer votre propos et la conclusion/discussion.
- Atelier Métabolomique
- Article 1 :
- Article 1 :
- Pan-cancer analysis of transcriptional metabolic dysregulation using The Cancer Genome Atlas
- Supplementary information à récupérer sur https://www.nature.com/articles/s41467-018-07232-8#additional-information
- Atelier ChipSeq
- Article 1 :
- Article 2 :
- Atelier Phylogénomique
- Atelier Modélisation
- Article 1 :
- Article 2 :
- A Quantitative Study of the Division Cycle of Caulobacter crescentus Stalked Cells
- Supplementary information à récupérer sur https://journals.plos.org/ploscompbiol/article?id=10.1371/journal.pcbi.0040009
Calendrier des présentations d'articles
EDT présentation des articles (les noms sont donnés pour rappel mais ordre de passage indifférent) | ||||
---|---|---|---|---|
lundi 28 septembre 9h30-12h : | articles Atelier Phylogénomique | article 1 : 9H30-10h30 (Codé, Laura D) | article 2 : 10h40-11h40 (Laura B, Tomas) | Commentaires : 11h40-12h |
lundi 28 septembre 13h45-16h15 : | articles Atelier Modélisation | article 1 : 13H45-14h45 (Alexia, Aurélien) | article 2 : 14h55-15h55 (Pierre, Safia) | Commentaires : 15h55-16h15 |
mardi 29 septembre 9h30-12h : | article Atelier Métabolomique | article 1 : 9H30-10h30 (Baptiste, Quentin) | article 2 : 10H40-11h40 (Antoine, Sophie) | Commentaires : 11h40-12h |
mardi 28 septembre 13h45-16h15 : | articles Atelier ChipSeq | article 1 : 13h45-14h45 (Jérémy, Valentine) | article 2 : 14h55-15h55 (Houyem, Refka) | Commentaires : 15h55-16h15 |
Intégration de Données Hétérogènes - Partie R. Barriot
- Approches
- Enrichissement
- Fusion de données et priorisation de gènes candidats
- Mise en oeuvre
- Projets IDH
Atelier Phylogénomique
Intervenants : Claire Hoede et Yves Quentin
Biologie des Systèmes - G. Czaplicki
Fichiers avec les codes :
Biologie des Systèmes - G. Fichant
Support de cours:
- Introduction to system biology
- Petit rappel enzymologie
- Complément rappel enzymologie
- Introduction to Petri net models
- Introduction to stochastic simulation
- Introduction parameter estimation
- Introduction to Piece-wise linear differential equation models
- System dynamic analyses
TP :
- Copasi user guide
- Lien vers le site de Snoopy : https://www-dssz.informatik.tu-cottbus.de/DSSZ/Software/Snoopy
- TP1 : modeling of the psp response when cell envelop is damaged
- TP2 : modeling of the repressilator:
- TP3 : modeling phosphate regulation in enterobacteria:
- TP4 : modeling of the regulation of lactose operon :
Master 2 - ADAM (Adaptation, Développement et Amélioration des plantes en présence de Microorganismes)
Biologie Computationnelle
Documents, partie E. Gaulin
Examen 2020-2021
Partie E. Gaulin
Veuillez trouver ci-dessous, la séquence fasta de l'ADNc PEP2 du champignon que l'on souhaite cloner dans le vecteur de destination pCAMBIA
>ADNc_PEP2
ACTTCCAAATTCTAGTATATGTAATCCTTTT GTTCGGGTTCATGATCGAATTCCAAAGAGTGGAAAACAAGCAAAAGGTTAAATATACATG CCATTTTTGGAGCTTTCGAGCTCATAACACAGGTGAGCGCGACGAATGGATCCCTCGCTA ATAACATCATGGTCGTGGGCGCCGTCCTTGCGGCGCTCGTCGCCGGCGGGTCGTGCGGGC CCCCGAAGGTGCCACCCGGCCCCAACATCACCACCAACTACAACGGCAAGTGGCTCACCG CTAGGGCCACCTGGTACGGTCAGCCCAACGGTGCCGGCGCTCCTGACAACGGCGGTGCGT GCGGGATCAAGAACGTGAACCTGCCACCCTACAGCGGCATGACGGCGTGCGGCAACGTCC CCATCTTCAAGGACGGCAAGGGCTGCGGCTCATGCTACGAGGTGAGATGCAAGGAAAAAC CTGAGTGCTCGGGCAATCCAGTCACGGTGTACATCACTGACATGAACTACGAACCTATCG CTCCCTACCACTTCGACTTGAGCGGCAAGGCCTTCGGCTCCCTGGCAAAGCCCGGGCTCA ACGACAAGATTCGCCACTGCGGCATCATGGACGTCGAGTTCAGAAGGGTGCGATGCAAGT ACCCCGCCGGGCAGAAGATCGTGTTCCACATCGAGAAGGGCTGCAACCCCAACTACCTGG CCGTGCTGGTGAAGTATGTGGCGGACGACGGCGACATCGTGCTGATGGAAATCCAGGACA AGTTGTCGGCTGAGTGGAAGCCCATGAAGCTCTCTTGGGGCGCCATCTGGAGGATGGACA CTGCCAAGGCGCTCAAGGGCCCCTTCTCCATCCGCCTCACCAGCGAGTCCGGCAAGAAGG TCATCGCCAAAGACGTCATCCCGGCGAACTGGAGACCCGATGCCGTCTACACTTCCAACG TCCAATTTTACGTAACTTTGAATTCCCTTCGATTCATCCGGCACAGCGGGCTATGGACCT TCAGCAGCAAGCTAATTAAGTTGGCAGCATGCACCGCTAACCTTATATACTACTGAGACT TCCAAATTCTAGTATATGTAATCCTTTTGTTCGGGTTCATGATCGAATTCCAAAGAGTGG AAAACAAGCAAAAGGTTAAATATACATGCCATTTTTGGAAGCTTGGCTTTCGAGGGTACC CCTGATAGTT
Partie C. Mathé
Partie C. Albenne
Culture
- Une histoire de tout ou presque... Bill Bryson, Payot, coll. "Petite Bibliothèque Payot" n° 851, 2012 (ISBN: 9782228907576)
- Norman Baillargeon - Petit cours d'autodéfense intellectuelle, Éditions Lux, collection Instinct de Liberté, 2005. (ISBN: 2-895960-44-5)
- Faire l'économie de la haine, Alain Deneault, 2018, Ecosociete Eds, coll. Polemos
- Comment tout peut s'effondrer. Petit manuel de collapsologie à l'usage des générations présentes. 2015. Pablo Servigne, :Raphaël Stevens. seuil
- Les sentiers de l'utopie, I. Fremeaux et J. Jordan, 2012.
F.A.Q.
- Caractérisation d'un ensemble de gènes d'intérêt. Soit qu'ils sont différentiellement exprimés, soit qu'ils sont co-exprimés.
- Installation de igraph sur CentOS 6.7 en P0
Sous R, l'installation d'igraph échoue avec le protocole https, il faut donc choisir un mirroir avec le protocol http : choseCRANmirror() dernier choix (http mirrors) puis Lyon2
R> chooseCRANmirror() R> install.packages('igraph')
- Installation de Rstudio sur CentOS 6.7 en P0
La dernière version de Rstudio desktop ne fonctionne pas pour CentOS6.7 (nécessite des librairies plus récentes). Il faut donc télécharger et installer la version serveur :
# Dans un terminal, passer root (super-utilisateur) bash> su # puis les commandes ci-dessous (sans le "root>") root> wget https://download2.rstudio.org/rstudio-server-rhel-0.99.892-x86_64.rpm root> yum install --nogpgcheck rstudio-server-rhel-0.99.892-x86_64.rpm
Ensuite, on accède à l'interface avec le navigateur : http://localhost:8787 avec un compte de la machine (normalement le compte guest)