Enseignements
From silico.biotoul.fr
(→Biologie des Systèmes - G. Fichant) |
|||
(280 intermediate revisions not shown) | |||
Line 1: | Line 1: | ||
= Licence 2 et 3 Biologie = | = Licence 2 et 3 Biologie = | ||
- | === Bioinformatique - 2B2M | + | === Bioinformatique - Option L2-L3 2B2M-BCP-BOPE === |
- | ===='''Emploi du temps | + | UE en option avec différents codes : |
+ | * L2 2B2M : EDSVB4IM | ||
+ | * L2 BCP : EDSVA4HM | ||
+ | * L2 BOPE : EDSVC4MM | ||
+ | * L3 BOPE : ELSVC6JM | ||
+ | |||
+ | * Moodle : [https://moodle.univ-tlse3.fr/course/view.php?id=2518 EDSVB4IM] | ||
+ | |||
+ | ===='''Emploi du temps 2019-20'''==== | ||
Aussi disponible sur https://calendar.google.com/calendar/embed?src=lic.bioinfo%40gmail.com&ctz=Europe/Paris | Aussi disponible sur https://calendar.google.com/calendar/embed?src=lic.bioinfo%40gmail.com&ctz=Europe/Paris | ||
+ | |||
+ | <html> | ||
+ | <iframe src="https://calendar.google.com/calendar/embed?showTitle=0&showCalendars=0&mode=AGENDA&height=400&wkst=2&hl=fr&bgcolor=%23FFFFFF&src=lic.bioinfo%40gmail.com&color=%232952A3&ctz=Europe%2FParis" style="border-width:0" width="550" height="400" frameborder="0" scrolling="no"></iframe> | ||
+ | </html> | ||
+ | |||
+ | |||
+ | |||
+ | <big><big>'''Les groupes de TD et TP 2019-20 sont disponibles sur moodle : [https://moodle.univ-tlse3.fr/course/view.php?id=2518 https://moodle.univ-tlse3.fr/course/view.php?id=2518]'''</big></big> | ||
+ | |||
{| class="wikitable" | {| class="wikitable" | ||
- | !colspan="4"|EDT L2 | + | !colspan="4"|EDT L2-L3 2B2M-BCP-BOPE Bioinformatique |
|- | |- | ||
- | | || CM | + | | || CM 3TP2-Einstein || TD || TP |
|- | |- | ||
- | | semaine 04 - | + | | semaine 04 - 20/01 || 13h30-15h40 R. Barriot Bioinfo générale || |
|- | |- | ||
- | | semaine 05 - | + | | semaine 05 - 27/01 || 13h30-15h40 F. Delavoie Imagerie || || 15h50-18h00 groupes gTP1 en 4TP4-P1 & gTP2 en 4TP4-P15 <br/> 18h10-20h20 groupe gTP3 en 4TP2-M6 |
|- | |- | ||
- | | semaine 06 - | + | | semaine 06 - 03/02 || 13h30-15h40 R. Barriot Bases de Données || 15h50-18h00 U2-116 groupe gTD1<br/>18h10-20h20 U2-116 groupe gTD2 || |
|- | |- | ||
- | | semaine | + | | semaine 07 - 10/02 || || || 13h30-15h40 groupe gTP1 en 4TP2-M7 <br/> 15h50-18h00 groupe gTP2 en 4TP4-P15 <br/> 18h10-20h20 groupe gTP3 en 4TP2-M6 |
|- | |- | ||
- | | semaine | + | | semaine 08 - 17/02 || || || |
|- | |- | ||
- | | semaine | + | | semaine 09 - 24/02 || 13h30-15h40 M. Bonhomme || || 15h50-18h00 groupes gTP1 en 4TP4-P1 & gTP2 en 4TP4-P15 <br/> 18h10-20h20 groupe gTP3 en 4TP2-M6 |
+ | |- | ||
+ | | semaine 10 - 02/03 || '''13h30-15h30 Contrôle continu en 4A-Leclerc''' || || | ||
+ | |- | ||
+ | | semaine 11 - 09/03 || 13h30-15h40 G. Fichant SysBio || || 15h50-18h00 groupes gTP1 en 4TP4-P1 & gTP2 en 4TP4-P15 <br/> 18h10-20h20 groupe gTP3 en 4TP2-M6 | ||
|- | |- | ||
- | | semaine | + | | semaine 12 - 16/03 || || 13h30-15h40 gTD1 en U2-220 <br/> 15h50-18h00 gTD2 en U2-219 || |
|- | |- | ||
- | | semaine | + | | semaine 13 - 23/03 || || || 13h30-15h40 groupe gTP1 en 4TP2-M7 <br/> 15h50-18h00 groupe gTP2 en 4TP4-P15 <br/> 18h10-20h20 groupe gTP3 en 4TP2-M6 |
|- | |- | ||
- | | semaine | + | | semaine 14 - 30/03 || '''13h30-15h30 Contrôle terminal anticipé en Eintein''' || || |
- | + | |} | |
- | + | ||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | <!-- | ||
|- | |- | ||
| semaine 20 - 15.05 || || || '''<span style='color: #F00'>12h-13h Consultation des copies en 4TP4-P15</span>''' | | semaine 20 - 15.05 || || || '''<span style='color: #F00'>12h-13h Consultation des copies en 4TP4-P15</span>''' | ||
- | |||
- | '''Groupes de | + | '''Groupes de TD''' |
{| style="border-collapse: separate; border-spacing: 0; border-width: 1px; border-style: solid; border-color: #aabbcc; padding: 3px; width: 100%; background-color: #bbccdd; text-align: center;" | {| style="border-collapse: separate; border-spacing: 0; border-width: 1px; border-style: solid; border-color: #aabbcc; padding: 3px; width: 100%; background-color: #bbccdd; text-align: center;" | ||
- | !colspan=" | + | !colspan="3"|Groupes de TD |
|- style="background-color: #ddeeff;" | |- style="background-color: #ddeeff;" | ||
| style="padding-left: 0.5em; border-width: 1px; border-style: solid;" | Groupe 1 | | style="padding-left: 0.5em; border-width: 1px; border-style: solid;" | Groupe 1 | ||
| style="padding-left: 0.5em; border-width: 1px; border-style: solid;" | Groupe 2 | | style="padding-left: 0.5em; border-width: 1px; border-style: solid;" | Groupe 2 | ||
- | |||
- | |||
|- style="background-color: #ddeeff;" | |- style="background-color: #ddeeff;" | ||
| style="padding-left: 0.5em; border-width: 1px; border-style: solid;" | | | style="padding-left: 0.5em; border-width: 1px; border-style: solid;" | | ||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
+ | L2 BCP<br/> | ||
+ | et<br/> | ||
+ | L2 2B2M (Nom de famille commençant par : A jusqu'à G inclus) | ||
| style="padding-left: 0.5em; border-width: 1px; border-style: solid;" | | | style="padding-left: 0.5em; border-width: 1px; border-style: solid;" | | ||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | + | L2/L3 BOPE<br/> | |
- | + | et | |
- | + | <br/> | |
- | + | L2 2B2M (Nom de famille commençant par : K à Z) | |
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
|} | |} | ||
+ | --> | ||
===='''Supports de cours'''==== | ===='''Supports de cours'''==== | ||
Line 121: | Line 90: | ||
* CM3 [[Media:LBioinfo.systemes.d.information.pdf|Introduction aux bases de données]] | * CM3 [[Media:LBioinfo.systemes.d.information.pdf|Introduction aux bases de données]] | ||
* CM4 [[Media:LBioinfo_Genetics_bis.pdf|Utilisation de l'information génétique en biologie]] | * CM4 [[Media:LBioinfo_Genetics_bis.pdf|Utilisation de l'information génétique en biologie]] | ||
- | * CM5 [[Media: | + | * CM5 [[Media:Intro_BioSyst_L2_2019.pdf|Introduction à la biologie des système : initiation à la modélisation de réseaux de gènes]] |
===='''Sujets de TD/TP'''==== | ===='''Sujets de TD/TP'''==== | ||
Line 131: | Line 100: | ||
* [[Media:L2-L3 Bioinfo - TD Transcriptomique.pdf|TD2]] Transcriptomique | * [[Media:L2-L3 Bioinfo - TD Transcriptomique.pdf|TD2]] Transcriptomique | ||
* [[Media:TP_modelisation_regulation_fls2.pdf|TP5 Modélisation d'un réseau de régulation]] | * [[Media:TP_modelisation_regulation_fls2.pdf|TP5 Modélisation d'un réseau de régulation]] | ||
- | * | + | ** [[Media:snoopy.7z|archive installation de snoopy]] |
- | + | ** [[Media:fls2_regulation_simplifie.spn|réseau de Petri stochastique pour la régulation de fls2]] | |
- | * [[Media:snoopy.7z|archive installation de snoopy]] | + | ** [[Media:TP_regulation_fls2.pdf|correction du TP5 Modélisation d'un réseau de régulation]] |
- | + | ||
=== BioAnalyse L3 BCP === | === BioAnalyse L3 BCP === | ||
Line 140: | Line 108: | ||
==='''Planning des Enseignements L3 BCP semestre 6 (ELSV6CM1)'''=== | ==='''Planning des Enseignements L3 BCP semestre 6 (ELSV6CM1)'''=== | ||
- | + | * [[Media:1920_Bioanalyse_planning.pdf|Planning Bioanalyse L3 BCP 2019_2020]] | |
+ | * [[Media:presentation_UE_bioanalyse_2020.pdf|Présentation de l'UE]] | ||
<!-- | <!-- | ||
- | * [[Media: | + | * [[Media:1819_Planning TPS CMs.pdf|Planning Bioanalyse L3 BCP 2018_2019]] |
+ | * [[Media:presentation_UE_bioanalyse_2019.pdf|Présentation de l'UE]] | ||
+ | |||
--> | --> | ||
===='''Cours'''==== | ===='''Cours'''==== | ||
- | * CM1 : [[Media: | + | * CM1 : [[Media:Introduction_bioinfo_2020_modified.pdf|Introduction à la bioinformatique]] |
- | * CM2 : [[Media: | + | * CM2 : [[Media:banque_2020.pdf|Introduction aux banques de données]] |
* CM3 : [[Media:Alignement_seq_nuc.pdf|Alignement de deux séquences d'acides nucléiques]] | * CM3 : [[Media:Alignement_seq_nuc.pdf|Alignement de deux séquences d'acides nucléiques]] | ||
* CM4 : [[Media:Alignement_seq_prot_2015.pdf|Alignement de deux séquences protéiques : les matrices de substitution]] | * CM4 : [[Media:Alignement_seq_prot_2015.pdf|Alignement de deux séquences protéiques : les matrices de substitution]] | ||
- | * CM5 : [[Media: | + | * CM5 : [[Media:Blast_2020.pdf|Recherche par similarité dans les bases de données]] |
* CM6 : [[Media:AlignementMultiple_2017.pdf|Alignement multiple]] | * CM6 : [[Media:AlignementMultiple_2017.pdf|Alignement multiple]] | ||
* CM6 : [[Media:motif_profil_2017.pdf|Motif et domaine fonctionnels]] | * CM6 : [[Media:motif_profil_2017.pdf|Motif et domaine fonctionnels]] | ||
Line 165: | Line 136: | ||
* CC 2014 : [[Media:Correction_sujet_CC_L3Biologie_EL6BIOFM_2014.pdf|Questions + corrections]] | * CC 2014 : [[Media:Correction_sujet_CC_L3Biologie_EL6BIOFM_2014.pdf|Questions + corrections]] | ||
* CC 2014 : [[Media:correction_alignement_CC_2013.pdf|correction de la construction de la matrice de programmation dynamique]] | * CC 2014 : [[Media:correction_alignement_CC_2013.pdf|correction de la construction de la matrice de programmation dynamique]] | ||
- | * CC 2013 : [[Media:Correction_sujet_CC_L3Biologie_EL6BIOFM.pdf|Questions + corrections]] | + | <!-- * CC 2013 : [[Media:Correction_sujet_CC_L3Biologie_EL6BIOFM.pdf|Questions + corrections]] |
- | * CC 2017 : [[Media:sujet_CC_Bioanalyse_L3BCP_2017_correction.pdf|Correction du contrôle continu 2017]] | + | * CC 2017 : [[Media:sujet_CC_Bioanalyse_L3BCP_2017_correction.pdf|Correction du contrôle continu 2017]] --> |
=== BioAnalyse L3 2B2M === | === BioAnalyse L3 2B2M === | ||
Line 189: | Line 160: | ||
* TP1 : [[TD1_Genome Selection Plantes|Interrogation des banques de données et recherche par similarité]] | * TP1 : [[TD1_Genome Selection Plantes|Interrogation des banques de données et recherche par similarité]] | ||
+ | <!-- | ||
* TP2 : [[TD2_Genome Selection Plantes|Alignement multiples et signatures proteiques]] | * TP2 : [[TD2_Genome Selection Plantes|Alignement multiples et signatures proteiques]] | ||
- | |||
==== Harmonisation des Connaissances, partie Bioanalyse (EMBIA1IM) ==== | ==== Harmonisation des Connaissances, partie Bioanalyse (EMBIA1IM) ==== | ||
* Supports de cours | * Supports de cours | ||
Line 281: | Line 252: | ||
'''Supports de cours :''' | '''Supports de cours :''' | ||
- | * [[Media:M1 Traitement de Donnees Biologiques - Statistiques et Analyses Multivariees.pdf|Statistiques | + | * [[Media:M1 Traitement de Donnees Biologiques - Statistiques et Analyses Multivariees.pdf|Statistiques - M. Bonhomme]] |
* [[Media:Transcriptome.pdf|Transcriptome - R. Barriot]] | * [[Media:Transcriptome.pdf|Transcriptome - R. Barriot]] | ||
Line 300: | Line 271: | ||
* [[M1 MABS TDB TD Transcriptome - Clustering|TD]] Transcriptome : clustering de profils d'expression | * [[M1 MABS TDB TD Transcriptome - Clustering|TD]] Transcriptome : clustering de profils d'expression | ||
--> | --> | ||
+ | |||
+ | <!-- | ||
+ | |||
+ | |||
<big>'''Contrôle continu'''</big> | <big>'''Contrôle continu'''</big> | ||
- | * Contrôle continu | + | * Contrôle continu 2019-20 : [[silico:enseignement/m1/tdb/CC2019/|Sujet et fichiers à utiliser]] |
+ | |||
+ | <big>'''Contrôle continu'''</big> | ||
+ | * Contrôle continu 2018-19 : [[silico:enseignement/m1/tdb/CC2018/|Sujet et fichiers à utiliser]] | ||
+ | |||
+ | <big>'''Contrôle continu'''</big> | ||
+ | * Contrôle continu 2017-18 : [[silico:enseignement/m1/tdb/CC2017/|Sujet et fichiers à utiliser]] | ||
+ | --> | ||
<!-- | <!-- | ||
Line 323: | Line 305: | ||
** RStudio : https://www.rstudio.com | ** RStudio : https://www.rstudio.com | ||
** https://www.datacamp.com Apprendre R en ligne | ** https://www.datacamp.com Apprendre R en ligne | ||
+ | ** https://rdrr.io/snippets/ Utilisation de R depuis un navigateur | ||
+ | <!-- deprecated | ||
** http://tryr.codeschool.com/levels/1/challenges/1 Apprendre en ligne aussi | ** http://tryr.codeschool.com/levels/1/challenges/1 Apprendre en ligne aussi | ||
** http://www.r-fiddle.org Utilisation de R depuis un navigateur | ** http://www.r-fiddle.org Utilisation de R depuis un navigateur | ||
+ | --> | ||
==== Génétique Evolutive et Quantitative (EMBIA1GM) ==== | ==== Génétique Evolutive et Quantitative (EMBIA1GM) ==== | ||
'''Support de cours:''' | '''Support de cours:''' | ||
- | * [[Media: | + | * [[Media: GEQ_presentation1.pdf|présentation de GEQ - M. Bonhomme]] |
* [[Media: GEQ_intro.pdf|introduction à GEQ - M. Bonhomme]] | * [[Media: GEQ_intro.pdf|introduction à GEQ - M. Bonhomme]] | ||
* [[Media: GEQ_pgen.pdf|GE - Génétique des populations - M. Bonhomme]] | * [[Media: GEQ_pgen.pdf|GE - Génétique des populations - M. Bonhomme]] | ||
- | * [[Media: | + | * [[Media: CM_Genetique_Quantitative_2019.pdf|GQ - Génétique-Quantitative - M. Bonhomme]] |
- | * [[Media: | + | * [[Media: Carto_Génétique_2019.pdf|GQ - Cartographie génétique - M. Bonhomme]] |
- | + | ||
- | + | ||
- | + | ||
'''Supports de TD/TP :''' | '''Supports de TD/TP :''' | ||
* [[Media: TD1_GEQ_pgen.pdf|TD1 génétique des populations]] | * [[Media: TD1_GEQ_pgen.pdf|TD1 génétique des populations]] | ||
* [[Media: TP1_genetic_diversity_drift.zip|TP1 génétique des populations]] | * [[Media: TP1_genetic_diversity_drift.zip|TP1 génétique des populations]] | ||
- | * [[Media: TD- | + | * [[Media: TD-Génétique_Quantitative_2019.pdf|TD2 génétique quantitative]] |
- | * [[Media: | + | * [[Media: TP_heritability.zip|TP2 génétique quantitative]] |
- | * [[Media: | + | * [[Media: TD3_carto_génétique_2019.pdf|TD3 cartographie génétique]] |
- | + | ||
=== Master 1 - Bioinformatique et Biologie des Systèmes + Biotechnologies === | === Master 1 - Bioinformatique et Biologie des Systèmes + Biotechnologies === | ||
Line 350: | Line 331: | ||
'''Supports de cours :''' | '''Supports de cours :''' | ||
* [[Media:CM1_EM_intro.pdf|Introduction à l'évolution moléculaire]] | * [[Media:CM1_EM_intro.pdf|Introduction à l'évolution moléculaire]] | ||
- | * [[Media: | + | * [[Media:Phylogenie_Definitions_2019.pdf|Evolution moléculaire : définitions]] |
- | * [[Media: | + | * [[Media:Phylogenie_Modeles_Evolutifs_2019.pdf|Modèles évolutifs]] |
- | * [[Media: | + | * [[Media:Phylogenie_Methodes_2019.pdf|Méthodes de reconstructions phylogénétiques ]] |
* [[Media:Phylogenie_Methodes_part2_2014.pdf|Méthodes de reconstructions phylogénétiques (suite)]] | * [[Media:Phylogenie_Methodes_part2_2014.pdf|Méthodes de reconstructions phylogénétiques (suite)]] | ||
- | * [[Media: | + | * [[Media:cours_EM_adapt_mol.pdf|Adaptation moléculaire]] |
'''Support TP : ''' | '''Support TP : ''' | ||
* [[silico:enseignement/m1-mabs/EvolMol/TD1/index.html|tutorial TP1 et TP2]] | * [[silico:enseignement/m1-mabs/EvolMol/TD1/index.html|tutorial TP1 et TP2]] | ||
- | * [[Media: | + | * [[Media:Introduction_competence_2020.pdf|Petit topo d'introduction sur la régulation de la compétence chez ''S. pneumoniae'']] |
- | <!--* [[Media: | + | <!--* [[Media:Correction_TP1_TP2_2018.pdf|Correction des TP1 et TP2]] --> |
- | * [[Media: | + | * [[Media:questions_reponses_ComD_ComE_trees_srep_2019.pdf|Questionnaire sur l'analyse des arbres ComE et ComD]] |
+ | <!--* [[Media:questions_reponses_ComD_ComE_trees_2020.pdf|Correction du questionnaire sur l'analyse des arbres ComE et ComD]] --> | ||
* [[Media:TP3_adaptation_moleculaire.zip|tutorial TP3]] | * [[Media:TP3_adaptation_moleculaire.zip|tutorial TP3]] | ||
+ | * [[Media:TP3_adaptation_moleculaire_2019_2020.zip|tutorial TP3_2019_2020]] | ||
'''Support TD : ''' | '''Support TD : ''' | ||
Line 394: | Line 377: | ||
==== Bioinformatique pour la Génomique (EMBIA1DM) ==== | ==== Bioinformatique pour la Génomique (EMBIA1DM) ==== | ||
'''Supports de cours :''' | '''Supports de cours :''' | ||
- | * [[Media: | + | * [[Media:Introduction_bio_annotation_2018.pdf|Introduction biologique (Gwennaele Fichant)]] |
* [[Media:Annotation1.pdf|Annotation partie 1 (Gwennaele Fichant)]] | * [[Media:Annotation1.pdf|Annotation partie 1 (Gwennaele Fichant)]] | ||
- | * [[Media: | + | * [[Media:annotation2_2019.pdf|Annotation partie 2 (Gwennaele Fichant)]] |
* [[Media:motif_profil_2017.pdf|Définition et identification des motifs et profils dans les séquences (cours de L3 Bioanalyse) (Gwennaele Fichant)]] | * [[Media:motif_profil_2017.pdf|Définition et identification des motifs et profils dans les séquences (cours de L3 Bioanalyse) (Gwennaele Fichant)]] | ||
* [[Media:HMM_2017.pdf|Modèle de Markov Caché (HMM) (Gwennaele Fichant)]] | * [[Media:HMM_2017.pdf|Modèle de Markov Caché (HMM) (Gwennaele Fichant)]] | ||
Line 402: | Line 385: | ||
'''Tutoriels de TP :''' | '''Tutoriels de TP :''' | ||
- | *[[silico:enseignement/m1-bioinfo/BG/TD_annotation/ | + | *[[silico:enseignement/m1-bioinfo/BG/TD_annotation/Tutorial_annotation_v1_2019.html|Annotation d'un fragment génomique bactérien]] |
<!--*[[silico:enseignement/m1-bioinfo/BG/summary_SignalP.pdf|Petite explication de SignalP]] --> | <!--*[[silico:enseignement/m1-bioinfo/BG/summary_SignalP.pdf|Petite explication de SignalP]] --> | ||
*[[silico:enseignement/m1-bioinfo/BG/TD_HMM/TD_HMM_2017.html| design d'un HMM pour prédire les promoteurs sigma A de B. subtilis]] | *[[silico:enseignement/m1-bioinfo/BG/TD_HMM/TD_HMM_2017.html| design d'un HMM pour prédire les promoteurs sigma A de B. subtilis]] | ||
Line 416: | Line 399: | ||
'''Contrôle continu :''' | '''Contrôle continu :''' | ||
- | *'''Rapport de TP''' sur le design d'un HMM à rendre au plus tard le ''' | + | *'''Rapport de TP''' sur le design d'un HMM à rendre au plus tard le '''lundi 14 octobre'''. M'envoyer par courrier le rapport en format pdf ainsi que le fichier en format texte comportant votre modèle avant estimation des probabilités. |
- | * '''Projet annotation''' d'un fragment génomique à remettre au plus tard '''le | + | * '''Projet annotation''' d'un fragment génomique à remettre au plus tard '''le lundi 9 décembre''' |
- | ** '''Description du travail à réaliser dans le fichier ci-joint''' : [[Media: | + | ** '''Description du travail à réaliser dans le fichier ci-joint''' : [[Media:Projet_2019.docx|description du projet]] |
- | ** '''Description du travail à réaliser pour les parsers dans le fichier ci-joint''' : [[Media: | + | ** '''Description du travail à réaliser pour les parsers dans le fichier ci-joint''' : [[Media:Description_parsers_2019.docx|description des parsers]] |
** '''Annoter une des deux séquences fournies''' : [[Media:seq1-5404.txt|séquence 1]] ou [[Media:seq2-7490.txt|séquence 2]] | ** '''Annoter une des deux séquences fournies''' : [[Media:seq1-5404.txt|séquence 1]] ou [[Media:seq2-7490.txt|séquence 2]] | ||
** [[Media:exemple_annotation_EMBL.txt|Exemple d'annotation au format EMBL]] | ** [[Media:exemple_annotation_EMBL.txt|Exemple d'annotation au format EMBL]] | ||
+ | |||
<!--* [[silico:enseignement/m1-mabs/BGPG/|Cours et TP]] | <!--* [[silico:enseignement/m1-mabs/BGPG/|Cours et TP]] | ||
* [[M1MABS BGPG Projets|Projets à remettre pour le '''17 mai''']] | * [[M1MABS BGPG Projets|Projets à remettre pour le '''17 mai''']] | ||
Line 440: | Line 424: | ||
==== Mathématique pour la Biologie (EMBIA1EM) ==== | ==== Mathématique pour la Biologie (EMBIA1EM) ==== | ||
- | + | ||
+ | '''Sujets de TP :''' | ||
+ | |||
* [[M1 MABS BBS Math TD Calcul Matriciel|TD]] Calcul matriciel | * [[M1 MABS BBS Math TD Calcul Matriciel|TD]] Calcul matriciel | ||
* [[M1 BBS Math TD ACP|TD]] ACP | * [[M1 BBS Math TD ACP|TD]] ACP | ||
Line 447: | Line 433: | ||
<!-- | <!-- | ||
- | ''' | + | <big>'''Exam TP'''</big> |
- | * | + | * Exam TP 2018-19 : [[silico:enseignement/m1/math/cc/|Sujet et fichiers à utiliser]] |
--> | --> | ||
+ | |||
+ | '''Liens :''' | ||
+ | * http://exercism.io : améliorer son niveau de programmation dans différents langages (notamment R) | ||
+ | |||
+ | '''Références''' | ||
+ | * ''Mathématiques pour les Sciences de la vie et de la Terre'' – C. David, S. Mustapha, F. Viens, N. Capron, edition Dunod | ||
+ | |||
+ | '''Projet 2019-20 :''' | ||
+ | * [[silico:enseignement/m1/math/projet/M1BBS_Math_Sujet_Projet_2019-20.html|Sujet du projet 2019-20]] | ||
+ | * Choix d'un graphe pour le projet (ne pas prendre un graphe déjà choisi par quelqu'un d'autre) : https://framadate.org/M1BBS-Projet-Math | ||
+ | * Les projets sont à rendre '''avant''' les fêtes de fin d'année | ||
+ | * Graphe à analyser | ||
+ | *# [[silico:enseignement/m1/math/projet/g1.gr|graphe 1]] | ||
+ | *# [[silico:enseignement/m1/math/projet/g2.gr|graphe 2]] | ||
+ | *# [[silico:enseignement/m1/math/projet/g3.gr|graphe 3]] | ||
+ | *# [[silico:enseignement/m1/math/projet/g4.gr|graphe 4]] | ||
+ | *# [[silico:enseignement/m1/math/projet/g5.gr|graphe 5]] | ||
+ | *# [[silico:enseignement/m1/math/projet/g6.gr|graphe 6]] | ||
+ | *# [[silico:enseignement/m1/math/projet/g7.gr|graphe 7]] | ||
+ | *# [[silico:enseignement/m1/math/projet/g8.gr|graphe 8]] | ||
+ | *# [[silico:enseignement/m1/math/projet/g9.gr|graphe 9]] | ||
+ | *# [[silico:enseignement/m1/math/projet/g10.gr|graphe 10]] | ||
+ | *# [[silico:enseignement/m1/math/projet/g11.gr|graphe 11]] | ||
+ | *# [[silico:enseignement/m1/math/projet/g12.gr|graphe 12]] | ||
+ | *# [[silico:enseignement/m1/math/projet/g13.gr|graphe 13]] | ||
+ | *# [[silico:enseignement/m1/math/projet/g14.gr|graphe 14]] | ||
+ | *# [[silico:enseignement/m1/math/projet/g15.gr|graphe 15]] | ||
+ | *# [[silico:enseignement/m1/math/projet/g16.gr|graphe 16]] | ||
+ | *# [[silico:enseignement/m1/math/projet/g17.gr|graphe 17]] | ||
+ | *# [[silico:enseignement/m1/math/projet/g18.gr|graphe 18]] | ||
+ | *# [[silico:enseignement/m1/math/projet/g19.gr|graphe 19]] | ||
+ | *# [[silico:enseignement/m1/math/projet/g20.gr|graphe 20]] | ||
+ | *# [[silico:enseignement/m1/math/projet/g21.gr|graphe 21]] | ||
+ | *# [[silico:enseignement/m1/math/projet/g22.gr|graphe 22]] | ||
+ | *# [[silico:enseignement/m1/math/projet/g23.gr|graphe 23]] | ||
+ | *# [[silico:enseignement/m1/math/projet/g24.gr|graphe 24]] | ||
+ | |||
+ | <!-- ARCHIVES | ||
+ | |||
+ | |||
+ | '''Projet 2018-19:''' | ||
+ | * [[silico:enseignement/m1/math/projet/M1BBS_Math_Sujet_Projet_2018-19.html|Sujet du projet 2018-19]] | ||
+ | * constitution des groupes (2 personnes par groupe) pour le projet : https://framadate.org/M1BBS-Groupes-Projet-Math | ||
+ | * Les projets sont à rendre '''avant''' les fêtes de fin d'année | ||
+ | * Graphe à analyser pour chaque groupe | ||
+ | *# [[silico:enseignement/m1/math/projet/g1.gr|Groupe 1]] | ||
+ | *# [[silico:enseignement/m1/math/projet/g2.gr|Groupe 2]] | ||
+ | *# [[silico:enseignement/m1/math/projet/g3.gr|Groupe 3]] | ||
+ | *# [[silico:enseignement/m1/math/projet/g4.gr|Groupe 4]] | ||
+ | *# [[silico:enseignement/m1/math/projet/g5.gr|Groupe 5]] | ||
+ | *# [[silico:enseignement/m1/math/projet/g6.gr|Groupe 6]] | ||
+ | *# [[silico:enseignement/m1/math/projet/g7.gr|Groupe 7]] | ||
+ | *# [[silico:enseignement/m1/math/projet/g8.gr|Groupe 8]] | ||
+ | *# [[silico:enseignement/m1/math/projet/g9.gr|Groupe 9]] | ||
+ | *# [[silico:enseignement/m1/math/projet/g10.gr|Groupe 10]] | ||
+ | |||
+ | |||
+ | |||
+ | *# [[silico:enseignement/m1/math/projet/Cleandb_Luca_2_A_1_1_65_Iso_Tr_1-CC1.gr|Groupe 1]] | ||
+ | *# [[silico:enseignement/m1/math/projet/Cleandb_Luca_2_A_1_1_65_Iso_Tr_1-CC2.gr|Groupe 2]] | ||
+ | *# [[silico:enseignement/m1/math/projet/Cleandb_Luca_2_A_1_1_65_Iso_Tr_1-CC3.gr|Groupe 3]] | ||
+ | *# [[silico:enseignement/m1/math/projet/Cleandb_Luca_3_A_1_1_65_Iso_Tr_1-CC1.gr|Groupe 4]] | ||
+ | *# [[silico:enseignement/m1/math/projet/Cleandb_Luca_4_A_1_1_65_Iso_Tr_1-CC1.gr|Groupe 5]] | ||
+ | *# [[silico:enseignement/m1/math/projet/Cleandb_Luca_4_A_1_1_65_Iso_Tr_1-CC2.gr|Groupe 6]] | ||
+ | *# [[silico:enseignement/m1/math/projet/Cleandb_Luca_5_A_1_1_65_Iso_Tr_1-CC1.gr|Groupe 7]] | ||
+ | *# [[silico:enseignement/m1/math/projet/|Groupe 8]] | ||
+ | *# [[silico:enseignement/m1/math/projet/|Groupe 9]] | ||
+ | *# [[silico:enseignement/m1/math/projet/|Groupe 10]] | ||
+ | |||
'''Projet 2017-18:''' | '''Projet 2017-18:''' | ||
Line 463: | Line 518: | ||
*# [[silico:enseignement/m1/math/projet/Cleandb_Luca_4_A_1_1_65_Iso_Tr_1-CC2.gr|Groupe 6]] | *# [[silico:enseignement/m1/math/projet/Cleandb_Luca_4_A_1_1_65_Iso_Tr_1-CC2.gr|Groupe 6]] | ||
*# [[silico:enseignement/m1/math/projet/Cleandb_Luca_5_A_1_1_65_Iso_Tr_1-CC1.gr|Marie G.]] | *# [[silico:enseignement/m1/math/projet/Cleandb_Luca_5_A_1_1_65_Iso_Tr_1-CC1.gr|Marie G.]] | ||
+ | |||
+ | |||
+ | <big>'''Exam TP'''</big> | ||
+ | * Exam TP 2017-18 : [[silico:enseignement/m1/math/cc/|Sujet et fichiers à utiliser]] | ||
+ | |||
+ | <!--* [[Media:M1 MABS BBS Math Memento.pdf|Memento]] de Régine André-Obrecht--> | ||
+ | |||
+ | <!-- | ||
+ | '''Contrôl continu décembre 2016''' | ||
+ | * Sujet au format [[silico:enseignement/m1/math/cc/2016.Math.CC.html|HTML]] et [[silico:enseignement/m1/math/cc/2016.Math.CC.Rmd|Rmd]] et l'image nécessaire pour la compilation au niveau du dernier exercice [[silico:enseignement/m1/math/cc/CC.nfbl.png|CC.nfbl.png]] | ||
+ | --> | ||
+ | |||
<!-- * [[M1 MABS CC Math 2012-12]] --> | <!-- * [[M1 MABS CC Math 2012-12]] --> | ||
Line 473: | Line 540: | ||
--> | --> | ||
- | |||
- | |||
Line 502: | Line 567: | ||
==== Traitement de graphes et réseaux biologiques (EMBIA1KM) ==== | ==== Traitement de graphes et réseaux biologiques (EMBIA1KM) ==== | ||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
'''Supports de cours''' | '''Supports de cours''' | ||
* [[Media:Traitement_de_graphes_et_reseaux_biologiques.pdf|Support de cours]] | * [[Media:Traitement_de_graphes_et_reseaux_biologiques.pdf|Support de cours]] | ||
+ | * [[Media:Traitement_des_graphes_et_reseaux_biologiques_communautes_v2019.pdf|Support de cours (communautés)]] | ||
<!-- | <!-- | ||
* [[Media:Traitement_des_graphes_et_reseaux_biologiques_communautes_v2013.pdf|Support de cours (communautés)]] | * [[Media:Traitement_des_graphes_et_reseaux_biologiques_communautes_v2013.pdf|Support de cours (communautés)]] | ||
- | |||
- | |||
+ | --> | ||
'''Supports de TD/TP:''' | '''Supports de TD/TP:''' | ||
- | * [[M1 BBS Graphes TP Visualisation| | + | * [[M1 BBS Graphes TP Visualisation|TP1]] Visualisation et exploration de graphes |
- | * [[M1 BBS Graphes TP Librairie - Parcours de graphes| | + | * [[M1 BBS Graphes TP Librairie - Parcours de graphes|TP1-2-3-4]] Librairie et parcours de graphes |
- | * [[M1 BBS Graphes TP | + | * [[M1 BBS Graphes TP Librairies R|TP4]] Librairies R |
- | * [[M1 BBS Graphes TP Recherche de communautés dans les graphes| | + | * [[M1 BBS Graphes TP Recherche de communautés dans les graphes|TP5]] Recherche de communautés dans les graphes |
+ | * [[M1 BBS Graphes TP Dessin et Introduction iGraph|TP archivé]] Dessin de graphes et initiation à la librairie iGraph | ||
+ | |||
- | '''Projets | + | '''Projets 2019-20''' |
* [[M1 BBS Graphes - Projets|Enoncé du projet]] | * [[M1 BBS Graphes - Projets|Enoncé du projet]] | ||
+ | |||
'''Liens:''' | '''Liens:''' | ||
+ | Logiciels | ||
* [http://cytoscape.org/ Cytoscape] (et [http://cytoscapeweb.cytoscape.org/ Cytoscape Web] mais un peu dépassé maintenant) | * [http://cytoscape.org/ Cytoscape] (et [http://cytoscapeweb.cytoscape.org/ Cytoscape Web] mais un peu dépassé maintenant) | ||
- | * [http://tulip.labri.fr/TulipDrupal/ Tulip] | + | * [http://tulip.labri.fr/TulipDrupal/ Tulip] librairie C/C++ pour le traitement et la visualisation de graphes |
* [https://gephi.org/ Gephi] | * [https://gephi.org/ Gephi] | ||
- | * [http://igraph.org/ igraph] | + | |
+ | Librairies | ||
+ | * [http://igraph.org/ igraph] R, python, ... | ||
+ | * [http://networkx.github.io NetworkX] python | ||
+ | * [https://graph-tool.skewed.de graph-tool] python | ||
+ | * [https://www.bioconductor.org/packages/release/bioc/html/STRINGdb.html Bioconductor/STRINGdb] interface STRINGdb et R igraph | ||
+ | |||
+ | Serveurs & Banques | ||
* [http://bioinformatics.ai.sri.com/ptools/ Pathway tools] | * [http://bioinformatics.ai.sri.com/ptools/ Pathway tools] | ||
- | |||
- | |||
* [http://www.metacyc.org/ METACYC] | * [http://www.metacyc.org/ METACYC] | ||
* [http://string-db.org/ STRING] | * [http://string-db.org/ STRING] | ||
- | * [ | + | * [http://deim.urv.cat/~sgomez/radatools.php Radatools] |
* [http://regulondb.ccg.unam.mx/ RegulonDb] | * [http://regulondb.ccg.unam.mx/ RegulonDb] | ||
* [http://metanetx.org/ MetaNetX] | * [http://metanetx.org/ MetaNetX] | ||
+ | |||
+ | Formats | ||
* Format GraphML http://graphml.graphdrawing.org/ et http://graphml.graphdrawing.org/primer/graphml-primer.html | * Format GraphML http://graphml.graphdrawing.org/ et http://graphml.graphdrawing.org/primer/graphml-primer.html | ||
+ | |||
+ | Autres | ||
+ | * https://kateto.net/network-visualization Visu avec différents environnements et librairies | ||
+ | * Visualisation de l'algorithme Floyd-Warshall https://www.cs.usfca.edu/~galles/visualization/Floyd.html | ||
+ | * [http://exercism.io exercism.io] : améliorer son niveau de programmation dans différents langages (notamment R) | ||
+ | * [http://rosalind.info rosalind] : apprentissage python en bioinformatique | ||
'''Références''' | '''Références''' | ||
Line 567: | Line 623: | ||
* <i>Kavosh: a new algorithm for finding network motifs</i>, Kashani <i>et al.</i>, BMC Bioinformatics, 2009. DOI:10.1186/1471-2105-10-318 | * <i>Kavosh: a new algorithm for finding network motifs</i>, Kashani <i>et al.</i>, BMC Bioinformatics, 2009. DOI:10.1186/1471-2105-10-318 | ||
* <i>Pathway discovery in metabolic networks by subgraph extraction</i>, Faust <i>et al.</i>, Bioinformatics, 1211-1218, 2010. DOI:10.1093/bioinformatics/btq105 | * <i>Pathway discovery in metabolic networks by subgraph extraction</i>, Faust <i>et al.</i>, Bioinformatics, 1211-1218, 2010. DOI:10.1093/bioinformatics/btq105 | ||
+ | |||
+ | <!-- | ||
+ | '''Emploi du temps 2015-16''' | ||
+ | Les CM ont lieu en salle S20, les TP en salle 4TP4-P1. | ||
+ | {| class="wikitable" | ||
+ | !colspan="4"|EDT M1 Traitement de graphes et réseaux biologiques | ||
+ | |- | ||
+ | | || CM mardi 15h45-17h45 en S20 || TP mercredi 13h30-17h30 en 4TP4-P1 | ||
+ | |- | ||
+ | | semaine 3 - 18.01 || RB CM1 Intro, notions et définitions || | ||
+ | |- | ||
+ | | semaine 4 - 25.01 || RB CM2 représentation et premiers algo (DFS) || | ||
+ | |- | ||
+ | | semaine 5 - 01.02 || RB CM3 algos (détection de cycles, tri topologique) || RB TP1 Cytoscape, DFS Python | ||
+ | |- | ||
+ | | semaine 6 - 08.02 || RB CM4 algos (BFS, Dijkstra, Floyd-Warshall) || | ||
+ | |- | ||
+ | | semaine 7 - 15.02 || RB CM5 algos (MST Kruskall et Prim, Marches aléatoires, TribeMCL, Motif / Kavosh) || RB TP2 BFS, plus courts chemins | ||
+ | |- | ||
+ | | semaine 8 - 22.01 || RB CM6 Dessin || | ||
+ | |- | ||
+ | | semaine 9 - 29.02 || || RB TP3 dessin, librairie igraph | ||
+ | |- | ||
+ | | semaine 10 - 07.03 || YQ Partitionnement et détection de communautés || YQ TP4 détection de communautés | ||
+ | |} | ||
+ | --> | ||
==== Fouille de données (EMBIA2DM) ==== | ==== Fouille de données (EMBIA2DM) ==== | ||
Line 621: | Line 703: | ||
'''Projet''' | '''Projet''' | ||
<!-- * [[M1 MABS BBS Data Mining Projet|Enoncé]] du projet --> | <!-- * [[M1 MABS BBS Data Mining Projet|Enoncé]] du projet --> | ||
- | * [[silico:enseignement/m1/datamining/projet/sujet.html|Sujet]] | + | * [[silico:enseignement/m1/datamining/projet/sujet.html|Sujet]] |
'''Liens''' | '''Liens''' | ||
Line 642: | Line 724: | ||
* <i>Data Mining: Concepts and Techniques</i>, J. Han and M. Kamber, 2006. | * <i>Data Mining: Concepts and Techniques</i>, J. Han and M. Kamber, 2006. | ||
* ''GENECODIS: a web-based tool for finding significant concurrent annotations in gene lists'', Carmona-Saez ''et al.'', Genome Biology, 2007. | * ''GENECODIS: a web-based tool for finding significant concurrent annotations in gene lists'', Carmona-Saez ''et al.'', Genome Biology, 2007. | ||
+ | * Petit cours d'autodéfense intellectuelle, Normand Baillargeon, 2006 | ||
=== Master 1 - MEEF === | === Master 1 - MEEF === | ||
Line 655: | Line 738: | ||
--> | --> | ||
- | + | ||
- | + | ||
<!-- | <!-- | ||
+ | * [[Media:1617_PlantesDomes.pdf|CM Plantes Domestiquees]] | ||
+ | |||
--> | --> | ||
== Master 2 == | == Master 2 == | ||
+ | === Master 2P Diagnostic moléculaire en microbiolgy === | ||
+ | =====Supports de cours ===== | ||
+ | * [[Media:annotation2_M2Diag_2019.pdf|Annotation génomes bactériens (Gwennaele Fichant)]] | ||
+ | * [[Media:Phylogenie_Definitions_2018_M2Diag.pdf|Définitions en phylogénie (Gwennaele Fichant)]] | ||
+ | * [[Media:Introduction_Phylogenie_2019_M2Diag.pdf|Introduction à la reconstruction phylogénétique (Gwennaele Fichant)]] | ||
+ | <!--* [[Media:annotation1_M2Diag_2018.pdf|Annotation partie 1 (Gwennaele Fichant)]] | ||
+ | * [[Media:annotation2_M2Diag_2018.pdf|Annotation partie 2 (Gwennaele Fichant)]] | ||
+ | * [[Media:Blast_2016.pdf|Recherche par similarité dans les bases de données (cours de L3 Bioanalyse)]]--> | ||
+ | |||
+ | =====Tutoriels de TP===== | ||
+ | *[[silico:enseignement/m1-bioinfo/BG/TD_annotation/Tutorial_annotation_v1_2019.html|Annotation d'un fragment génomique bactérien]] | ||
+ | |||
+ | * [[silico:enseignement/m1-mabs/EvolMol/TD1/index.html|Analyse évolutive de la cascade de régulation de la compétence chez les Streptocoques]] | ||
+ | * [[Media:Introduction_competence_2017.pdf|Petit topo d'introduction sur la régulation de la compétence chez ''S. pneumoniae'']] | ||
+ | |||
+ | * [[silico:enseignement/m2pro-diag/Bioinfo/TD_16srRNA/16SRNA_Tutorial_de _BioInformatique.htm|Identification des bactéries à l'aide de l'ARNr 16S]] | ||
=== Master 2 - Bioinformatique et Biologie des Systèmes === | === Master 2 - Bioinformatique et Biologie des Systèmes === | ||
Line 671: | Line 771: | ||
--> | --> | ||
===== Atelier système ===== | ===== Atelier système ===== | ||
- | * [[M2BBS - Atelier Système]] | + | * [[M2BBS - Atelier Système]] |
+ | |||
+ | ==== Atelier Chipseq ==== | ||
+ | **[[silico:enseignement/m2BBS/ChipSeq/TP_CHIPSEQ_2019_M2Bioinfo_FolderEtudiants.tar.gz|données TP]] | ||
+ | |||
+ | ===== Atelier Galaxy ===== | ||
+ | |||
+ | * http://genoweb.toulouse.inra.fr/~formation/8_Galaxy_Admin/2019/ | ||
===== UE Communication ===== | ===== UE Communication ===== | ||
=====liste des publications à présenter en préparation des ateliers:===== | =====liste des publications à présenter en préparation des ateliers:===== | ||
- | '''Chaque publication sera choisie par deux étudiant(e)s | + | '''Chaque publication sera choisie par deux étudiant(e)s. La présentation de la publication est personnelle. Donc chaque personne préparera une présentation powerpoint (ou pdf), diapositives en anglais, de 15 minutes qui sera suivie de 10 minutes de questions. La présentation et les questions se feront en français. Attention, ne pas oublier de consulter et de récupérer les supplementary data. La présentation devra faire ressortir la problématique abordée (question posée et contexte), la démarche bioinformatique adoptée, les résultats sous forme synthétisée avec choix pertinent des figures pour illustrer votre propos et la conclusion/discussion. |
''' | ''' | ||
* '''Atelier Métabolomique''' | * '''Atelier Métabolomique''' | ||
** Article 1 : | ** Article 1 : | ||
- | *** [[Media: | + | *** [[Media:Frezza2011.pdf|Haem oxygenase is synthetically lethal with the tumour suppressor fumarate hydratase]] |
- | + | ||
* '''Atelier ChipSeq''' | * '''Atelier ChipSeq''' | ||
** Article 1 : | ** Article 1 : | ||
*** [[Media:GenomeBiol2008.pdf|Model-based Analysis of ChIP-Seq (MACS)]] | *** [[Media:GenomeBiol2008.pdf|Model-based Analysis of ChIP-Seq (MACS)]] | ||
- | *** Supplementary information | + | *** [[Media:MACS_Sup_data.pdf |Supplementary information]] |
** Article 2 : | ** Article 2 : | ||
- | *** [[Media: | + | *** [[Media:Buenrostro_2018.pdf|Integrated Single-Cell Analysis Maps the Continuous Regulatory Landscape of Human Hematopoietic Differentiation]] |
- | *** | + | *** Supplementary information à récupérer sur https://www.sciencedirect.com/science/article/pii/S009286741830446X?via%3Dihub |
* '''Atelier Phylogénomique''' | * '''Atelier Phylogénomique''' | ||
** Article 1 : | ** Article 1 : | ||
- | *** [[Media: | + | *** [[Media:Thakur_Guttman_2016.pdf| A De-Novo Genome Analysis Pipeline (DeNoGAP) for large-scale comparative prokaryotic genomics studies]] |
- | *** Supplementary information à récupérer sur | + | *** Supplementary information à récupérer sur https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-016-1142-2 |
** Article 2 | ** Article 2 | ||
- | ***[[Media: | + | ***[[Media:Ali_et_al_2019.pdf|Identifying Clusters of High Confidence Homologies in Multiple Sequence Alignments]] |
- | + | ||
* '''Atelier Modélisation''' | * '''Atelier Modélisation''' | ||
** Article 1 : | ** Article 1 : | ||
- | *** [[Media: | + | *** [[Media:Weyder_et_al_2018.pdf|Dynamic Modeling of Streptococcus pneumoniae Competence Provides Regulatory Mechanistic Insights Into Its Tight Temporal Regulation]] |
- | *** | + | *** Supplementary information à récupérer sur https://www.frontiersin.org/articles/10.3389/fmicb.2018.01637/full#supplementary-material |
** Article 2 : | ** Article 2 : | ||
- | *** [[Media: | + | *** [[Media:Li_et_al_2008.pdf|A Quantitative Study of the Division Cycle of Caulobacter crescentus Stalked Cells]] |
- | + | *** Supplementary information à récupérer sur https://journals.plos.org/ploscompbiol/article?id=10.1371/journal.pcbi.0040009 | |
- | *** | + | |
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
===== Calendrier des présentations ===== | ===== Calendrier des présentations ===== | ||
{| class="wikitable" | {| class="wikitable" | ||
- | !colspan=" | + | !colspan="5"|EDT présentation des articles (les noms sont donnés pour rappel mais ordre de passage indifférent sauf Fulya 1ère) |
|- | |- | ||
- | |lundi | + | |lundi 23 septembre 9h30-11h30 : |
- | | | + | |articles Atelier Métabolomique |
+ | |article 1 : 9H30-11h00 (Juliette, Matthieu, Marine) | ||
+ | | | ||
+ | ||Commentaires : 11h-11h30 | ||
|- | |- | ||
- | | | + | |lundi 23 septembre 13h30-16h : |
- | |articles Atelier | + | |articles Atelier Modélisation |
- | |article | + | |article 1 : 13H30-14h30 (Alex, Soufiane) |
- | |article | + | |article 2 : 14h30-15h30 (Eve, Clara) |
+ | |Commentaires : 15h30-16h | ||
|- | |- | ||
- | |mardi | + | |mardi 24 septembre 9h30-12h : |
- | | | + | |article Atelier Phylogénomique |
- | |article | + | |article 2 : 9H30-10h30 (Tristan, Geoffrey) |
- | |article | + | |article 1 : 10H30-11h30 (Elise, Chloé) |
+ | |Commentaires : 11h30-12h | ||
|- | |- | ||
- | |mardi | + | |mardi 24 septembre 14h-16h30 : |
- | |articles Atelier | + | |articles Atelier ChipSeq |
- | |article | + | |article 1 : 14h-15h (Marion, Julien) |
- | |article | + | |article 2 : 15h-16h (Nicolas, Cheryn) |
- | | | + | |Commentaires : 16h-16h30 |
- | + | ||
- | + | ||
- | + | ||
- | + | ||
|} | |} | ||
Line 754: | Line 856: | ||
* [[Media:coal_cours.pdf|Coalescence : principe et bases théoriques]] ''' | * [[Media:coal_cours.pdf|Coalescence : principe et bases théoriques]] ''' | ||
* [[Media:coal_td.pdf|TD de génétique des populations]] ''' | * [[Media:coal_td.pdf|TD de génétique des populations]] ''' | ||
- | * [[Media:Mol_Biol_Evol-1999-Pritchard-1791-8.pdf|article : investigation de l'histoire démographique du chromosome Y par analyse des loci microsatellite]] ''' | + | * [[Media:tp_struc.pdf|TP : Diversité génétique d’une population structurée]] ''' |
+ | <!-- * [[Media:Mol_Biol_Evol-1999-Pritchard-1791-8.pdf|article : investigation de l'histoire démographique du chromosome Y par analyse des loci microsatellite]] '''--> | ||
* [[Media:cours_tp_hapFLK.pdf|cours et TP de détection de locus sous sélection positive]] ''' | * [[Media:cours_tp_hapFLK.pdf|cours et TP de détection de locus sous sélection positive]] ''' | ||
Line 761: | Line 864: | ||
*[[silico:enseignement/m2BBS/Genet_Stat/tp_coal.html|TP : simulations de données génétiques par coalescence fichier format html]] | *[[silico:enseignement/m2BBS/Genet_Stat/tp_coal.html|TP : simulations de données génétiques par coalescence fichier format html]] | ||
*[[Media:tp_abc.pdf|TP estimation de paramètres par une approche ABC]] ''' | *[[Media:tp_abc.pdf|TP estimation de paramètres par une approche ABC]] ''' | ||
- | *[[https://github.com/willyrv/BioInfoCours]] autres documents | + | <!-- *[[https://github.com/willyrv/BioInfoCours]] autres documents --> |
+ | |||
+ | =====Atelier Phylogénomique===== | ||
+ | Intervenants : Hélène Chiapello, Claire Hoede et Yves Quentin | ||
+ | |||
+ | [http://silico.biotoul.fr/p/Atelier_Phylog%C3%A9nomique Atelier de Phylogénomique] | ||
===== Biologie des Systèmes - R. Barriot ===== | ===== Biologie des Systèmes - R. Barriot ===== | ||
Line 767: | Line 875: | ||
* [[M2 BBS TP GRNs]] | * [[M2 BBS TP GRNs]] | ||
+ | |||
+ | ===== Biologie des Systèmes - G. Czaplicki ===== | ||
+ | |||
+ | * [[Media:document_GC.pdf|Support de cours]] ''' | ||
+ | |||
+ | Fichiers avec les codes : | ||
+ | * [[Media:banana.m|banana.m]] ''' | ||
+ | * [[Media:ftest.m|ftest.m]] ''' | ||
+ | * [[Media:Rate.m|Rate.m]] ''' | ||
+ | * [[Media:SMarquardt.m|SMarquardt.m]] ''' | ||
+ | * [[Media:compet.dat|compet.dat]] ''' | ||
===== Biologie des Systèmes - G. Fichant ===== | ===== Biologie des Systèmes - G. Fichant ===== | ||
Support de cours: | Support de cours: | ||
* [[Media:Intro_BioSyst_2017.pdf|Introduction to system biology]] ''' | * [[Media:Intro_BioSyst_2017.pdf|Introduction to system biology]] ''' | ||
- | * [[Media: | + | * [[Media:Rappel_enzymo_v1.pdf|Petit rappel enzymologie]]''' |
- | * [[Media: | + | * [[Media:SCAN_rappel_enzymo.pdf|Complément rappel enzymologie]]''' |
<!--* [[Media:network_motifs.pdf|Two and three nodes network motifs in transcriptional networks]]'''--> | <!--* [[Media:network_motifs.pdf|Two and three nodes network motifs in transcriptional networks]]'''--> | ||
- | * [[Media: | + | * [[Media:Petri_net_2019.pdf|Introduction to Petri net models]]''' |
* [[Media:Modele_stochastique.pdf|Introduction to stochastic simulation]]''' | * [[Media:Modele_stochastique.pdf|Introduction to stochastic simulation]]''' | ||
- | * [[Media: | + | * [[Media:parameter_estimation_2019.pdf|Introduction parameter estimation]]''' |
* [[Media:Intro_PL_2015.pdf|Introduction to Piece-wise linear differential equation models]]''' | * [[Media:Intro_PL_2015.pdf|Introduction to Piece-wise linear differential equation models]]''' | ||
* [[Media:Model_analysis.pdf| System dynamic analyses ]]''' | * [[Media:Model_analysis.pdf| System dynamic analyses ]]''' | ||
Line 783: | Line 902: | ||
'''TP :''' | '''TP :''' | ||
+ | * [[Media:CopasiUserguide-20100803-1.pdf|Copasi user guide]] | ||
+ | * Lien vers le site de Snoopy : https://www-dssz.informatik.tu-cottbus.de/DSSZ/Software/Snoopy | ||
+ | |||
*'''TP1 : modeling of the psp response when cell envelop is damaged''' | *'''TP1 : modeling of the psp response when cell envelop is damaged''' | ||
** [[Media:Toni_et_al_2011.pdf|article support]] | ** [[Media:Toni_et_al_2011.pdf|article support]] | ||
** [[Media:constante_stochastic_2017-18.png|constantes stochastiques]] | ** [[Media:constante_stochastic_2017-18.png|constantes stochastiques]] | ||
- | ** [[Media:psp_system_dm.txt|membrane data]] | + | ** [[Media:modele_psp_save_2017-18.spn|Modèle stochastique corrigé]] |
+ | <!--** [[Media:psp_system_dm.txt|membrane data]] | ||
** [[Media:psp_system_hBCA.txt|hBCA data]] | ** [[Media:psp_system_hBCA.txt|hBCA data]] | ||
** [[Media:psp_system_olg.txt|olg data]] | ** [[Media:psp_system_olg.txt|olg data]] | ||
** [[Media:psp_system_hBCAF.txt|hBCAF data]] | ** [[Media:psp_system_hBCAF.txt|hBCAF data]] | ||
- | ** [[Media:psp_system_hBcCcA.txt|hBcAcCc data]] | + | ** [[Media:psp_system_hBcCcA.txt|hBcAcCc data]]--> |
- | *'''TP2 : modeling of the | + | |
- | ** [[Media: | + | |
- | ** [[Media: | + | *'''TP2 : modeling of the repressilator:''' |
- | *'''TP3 : modeling of the | + | ** [[Media:tp_repressilator_2019.pdf|Short description of the repressilator regulation]] |
- | ** [[Media: | + | ** [[Media:repressilator_continu_2018_time_serie_500.csv|protein time series data]] |
- | ** [[Media: | + | ** [[Media:repressilator_continu_2018.cpn|Modèle corrigé continu avec Snoopy]] |
- | ** [[Media: | + | ** [[Media:repressilator_prot.cps|Modèle corrigé Copasi]] |
+ | ** [[Media:repressilator.Rmd|script R pour intégration ODE]] | ||
+ | |||
+ | |||
+ | <!-- ** [[Media:constante_stochastique.png|stochastic constant file]] | ||
+ | ** [[Media:constante_continu.png|ODE parameter file]] --> | ||
+ | |||
+ | *'''TP3 : modeling phosphate regulation in enterobacteria:''' | ||
+ | ** [[Media:TP_phosphate_new_2018.pdf|Short biological description of the phosphate regulation]] | ||
+ | ** [[Media:PN_extended_phosphate.xpn|Modèle "extended Petri Net" corrigé]] | ||
+ | ** [[Media:modele_stochastique_switch.spn|Modèle stochastique corrigé]] | ||
+ | |||
+ | |||
+ | *'''TP4 : modeling of the regulation of lactose operon :''' | ||
+ | ** [[Media:operon_lactose_description_2018.pdf|Short biological description of the lactose operon regulation]] | ||
+ | ** [[Media:operon_lac_2018_last.spn|Modèle stochastique corrigé]] | ||
+ | <!-- ** [[Media:constantes_2017.txt|stochastic constant file]] | ||
+ | ** [[Media:Constante_parameter_lactose_stochastique_2017.PNG|screen shot of the constant definition in the model]]--> | ||
=== Master 2 - [http://sciences-vegetales.univ-tlse3.fr/presentation-m2-adam-609174.kjsp?RH=1449138073206&RF=1450299526893 ADAM] (Adaptation, Développement et Amélioration des plantes en présence de Microorganismes)=== | === Master 2 - [http://sciences-vegetales.univ-tlse3.fr/presentation-m2-adam-609174.kjsp?RH=1449138073206&RF=1450299526893 ADAM] (Adaptation, Développement et Amélioration des plantes en présence de Microorganismes)=== | ||
Line 805: | Line 945: | ||
'''Documents, partie E. Gaulin''' | '''Documents, partie E. Gaulin''' | ||
- | * [[ | + | * [[M2R_ADAM|Clonage in silico_BenchLing]] |
+ | * [[M2R_BV|Clonage in silico_pDRAW]] | ||
- | '''Examen | + | <!-- |
- | + | ------------------------------------------------------- | |
- | + | '''Examen 2019-2020''' | |
- | |||
- | |||
- | ''' | + | '''Partie E. Gaulin''' |
+ | |||
+ | Veuillez trouver ci-dessous, la séquence fasta de l'ORF du gène X (1 171 bases) que l'on souhaite cloner dans le vecteur pCAMBIA | ||
+ | |||
+ | '''>ORF_X''' | ||
+ | |||
+ | ACTTCCAAATTCTAGTATATGTAATCCTTTT | ||
+ | GTTCGGGTTCATGATCGAATTCCAAAGAGTGGAAAACAAGCAAAAGGTTAAATATACATG | ||
+ | CCATTTTTGGAGCTTTCGAGCTCATAACACAGGTGAGCGCGACGAATGGATCCCTCGCTA | ||
+ | ATAACATCATGGTCGTGGGCGCCGTCCTTGCGGCGCTCGTCGCCGGCGGGTCGTGCGGGC | ||
+ | CCCCGAAGGTGCCACCCGGCCCCAACATCACCACCAACTACAACGGCAAGTGGCTCACCG | ||
+ | CTAGGGCCACCTGGTACGGTCAGCCCAACGGTGCCGGCGCTCCTGACAACGGCGGTGCGT | ||
+ | GCGGGATCAAGAACGTGAACCTGCCACCCTACAGCGGCATGACGGCGTGCGGCAACGTCC | ||
+ | CCATCTTCAAGGACGGCAAGGGCTGCGGCTCATGCTACGAGGTGAGATGCAAGGAAAAAC | ||
+ | CTGAGTGCTCGGGCAATCCAGTCACGGTGTACATCACTGACATGAACTACGAACCTATCG | ||
+ | CTCCCTACCACTTCGACTTGAGCGGCAAGGCCTTCGGCTCCCTGGCAAAGCCCGGGCTCA | ||
+ | ACGACAAGATTCGCCACTGCGGCATCATGGACGTCGAGTTCAGAAGGGTGCGATGCAAGT | ||
+ | ACCCCGCCGGGCAGAAGATCGTGTTCCACATCGAGAAGGGCTGCAACCCCAACTACCTGG | ||
+ | CCGTGCTGGTGAAGTATGTGGCGGACGACGGCGACATCGTGCTGATGGAAATCCAGGACA | ||
+ | AGTTGTCGGCTGAGTGGAAGCCCATGAAGCTCTCTTGGGGCGCCATCTGGAGGATGGACA | ||
+ | CTGCCAAGGCGCTCAAGGGCCCCTTCTCCATCCGCCTCACCAGCGAGTCCGGCAAGAAGG | ||
+ | TCATCGCCAAAGACGTCATCCCGGCGAACTGGAGACCCGATGCCGTCTACACTTCCAACG | ||
+ | TCCAATTTTACGTAACTTTGAATTCCCTTCGATTCATCCGGCACAGCGGGCTATGGACCT | ||
+ | TCAGCAGCAAGCTAATTAAGTTGGCAGCATGCACCGCTAACCTTATATACTACTGAGACT | ||
+ | TCCAAATTCTAGTATATGTAATCCTTTTGTTCGGGTTCATGATCGAATTCCAAAGAGTGG | ||
+ | AAAACAAGCAAAAGGTTAAATATACATGCCATTTTTGGAAGCTTGGCTTTCGAGGGTACC | ||
+ | CCTGATAGTT | ||
+ | |||
+ | |||
+ | '''Partie C. Mathé''' | ||
* [http://genoweb.toulouse.inra.fr/~mathe/M2RBV/Exam_Blast.htm Lien vers un BLAST sauvegardé] | * [http://genoweb.toulouse.inra.fr/~mathe/M2RBV/Exam_Blast.htm Lien vers un BLAST sauvegardé] | ||
- | + | '''Partie C. Albenne''' | |
+ | |||
+ | *[[Media:PGIP.pdb|Lien vers le PGIP]] | ||
+ | |||
+ | |||
+ | ------------------------------------------- | ||
+ | |||
+ | |||
+ | '''Examen 2018-2019''' | ||
+ | |||
+ | '''Partie E. Gaulin''' | ||
+ | * [[M2R|Cartes et Sites de Restriction]] | ||
+ | |||
+ | '''Partie C. Mathé''' | ||
+ | * [http://genoweb.toulouse.inra.fr/~mathe/M2RBV/Exam_Blast.htm Lien vers un BLAST sauvegardé] | ||
+ | |||
+ | '''Partie C. Albenne''' | ||
+ | *[[Media:M2R_2018-Albenne.pdf|Sujet C Albenne]] | ||
+ | |||
+ | |||
+ | *[[Media:EXPB1.doc|EXPB1]] | ||
+ | *[[Media:2hcz.dsv|Structure]] | ||
+ | |||
+ | |||
+ | |||
+ | --------------------------------------------- | ||
+ | |||
+ | |||
+ | '''Examen 2017, partie E. Gaulin''' <br> | ||
+ | |||
+ | '''Documents, sujet C Albenne''' | ||
+ | *[[Media:M2R_2017-Albenne.pdf|Sujet C Albenne]] | ||
+ | |||
'''Examen 2016, partie E. Gaulin''' <br> | '''Examen 2016, partie E. Gaulin''' <br> | ||
Line 828: | Line 1,028: | ||
* [[M2R|Cartes et Sites de Restriction]] | * [[M2R|Cartes et Sites de Restriction]] | ||
- | |||
- | |||
- | |||
'''Documents, partie C. Albenne''' | '''Documents, partie C. Albenne''' | ||
* [[Media:EXP1.doc|Sequence fasta EXPB1]] | * [[Media:EXP1.doc|Sequence fasta EXPB1]] | ||
* [[Media:2HCZ.pdb|Structure PDB]] | * [[Media:2HCZ.pdb|Structure PDB]] | ||
+ | |||
+ | ------------------------------------------------- | ||
+ | |||
+ | ==== Biologie Computationnelle (2019) ==== | ||
+ | |||
+ | * [[M2R_ADAM|In silico cloning]] | ||
+ | |||
--> | --> | ||
+ | |||
+ | = Culture = | ||
+ | |||
+ | * Une histoire de tout ou presque... Bill Bryson, Payot, coll. "Petite Bibliothèque Payot" n° 851, 2012 (ISBN: 9782228907576) | ||
+ | * Norman Baillargeon - Petit cours d'autodéfense intellectuelle, Éditions Lux, collection Instinct de Liberté, 2005. (ISBN: 2-895960-44-5) | ||
+ | * Faire l'économie de la haine, Alain Deneault, 2018, Ecosociete Eds, coll. Polemos | ||
+ | * Comment tout peut s'effondrer. Petit manuel de collapsologie à l'usage des générations présentes. 2015. Pablo Servigne, :Raphaël Stevens. seuil | ||
+ | * Les sentiers de l'utopie, I. Fremeaux et J. Jordan, 2012. | ||
= F.A.Q. = | = F.A.Q. = |
Revision as of 12:14, 17 February 2020
Licence 2 et 3 Biologie
Bioinformatique - Option L2-L3 2B2M-BCP-BOPE
UE en option avec différents codes :
- L2 2B2M : EDSVB4IM
- L2 BCP : EDSVA4HM
- L2 BOPE : EDSVC4MM
- L3 BOPE : ELSVC6JM
- Moodle : EDSVB4IM
Emploi du temps 2019-20
Aussi disponible sur https://calendar.google.com/calendar/embed?src=lic.bioinfo%40gmail.com&ctz=Europe/Paris
Les groupes de TD et TP 2019-20 sont disponibles sur moodle : https://moodle.univ-tlse3.fr/course/view.php?id=2518
EDT L2-L3 2B2M-BCP-BOPE Bioinformatique | |||
---|---|---|---|
CM 3TP2-Einstein | TD | TP | |
semaine 04 - 20/01 | 13h30-15h40 R. Barriot Bioinfo générale | ||
semaine 05 - 27/01 | 13h30-15h40 F. Delavoie Imagerie | 15h50-18h00 groupes gTP1 en 4TP4-P1 & gTP2 en 4TP4-P15 18h10-20h20 groupe gTP3 en 4TP2-M6 | |
semaine 06 - 03/02 | 13h30-15h40 R. Barriot Bases de Données | 15h50-18h00 U2-116 groupe gTD1 18h10-20h20 U2-116 groupe gTD2 | |
semaine 07 - 10/02 | 13h30-15h40 groupe gTP1 en 4TP2-M7 15h50-18h00 groupe gTP2 en 4TP4-P15 18h10-20h20 groupe gTP3 en 4TP2-M6 | ||
semaine 08 - 17/02 | |||
semaine 09 - 24/02 | 13h30-15h40 M. Bonhomme | 15h50-18h00 groupes gTP1 en 4TP4-P1 & gTP2 en 4TP4-P15 18h10-20h20 groupe gTP3 en 4TP2-M6 | |
semaine 10 - 02/03 | 13h30-15h30 Contrôle continu en 4A-Leclerc | ||
semaine 11 - 09/03 | 13h30-15h40 G. Fichant SysBio | 15h50-18h00 groupes gTP1 en 4TP4-P1 & gTP2 en 4TP4-P15 18h10-20h20 groupe gTP3 en 4TP2-M6 | |
semaine 12 - 16/03 | 13h30-15h40 gTD1 en U2-220 15h50-18h00 gTD2 en U2-219 | ||
semaine 13 - 23/03 | 13h30-15h40 groupe gTP1 en 4TP2-M7 15h50-18h00 groupe gTP2 en 4TP4-P15 18h10-20h20 groupe gTP3 en 4TP2-M6 | ||
semaine 14 - 30/03 | 13h30-15h30 Contrôle terminal anticipé en Eintein |
Supports de cours
- CM1 Introduction à la bioinformatique
- CM2 Traitement d'images
- CM3 Introduction aux bases de données
- CM4 Utilisation de l'information génétique en biologie
- CM5 Introduction à la biologie des système : initiation à la modélisation de réseaux de gènes
Sujets de TD/TP
- TP1 Traitement d'images
- TD1 Bases de données
- TP2 Bases de données
- TP3 Analyses statistiques des données (phénotypes,génotypes)
- TP4 Banques de données et analyse de séquences
- TD2 Transcriptomique
- TP5 Modélisation d'un réseau de régulation
BioAnalyse L3 BCP
Planning des Enseignements L3 BCP semestre 6 (ELSV6CM1)
Cours
- CM1 : Introduction à la bioinformatique
- CM2 : Introduction aux banques de données
- CM3 : Alignement de deux séquences d'acides nucléiques
- CM4 : Alignement de deux séquences protéiques : les matrices de substitution
- CM5 : Recherche par similarité dans les bases de données
- CM6 : Alignement multiple
- CM6 : Motif et domaine fonctionnels
TPs
- TP1 : Interrogation des banques de données
- TP2 : Alignement par paires
- TP3 : Analyse de séquences et biologie Moléculaire
- TP4 : BLAST, alignement multiple, signature protéique
- TP5 : Revisions
Exemples de contrôle continu corrigé
- CC 2014 : Questions + corrections
- CC 2014 : correction de la construction de la matrice de programmation dynamique
BioAnalyse L3 2B2M
TPs
- TP1 : Interrogation des banques de données
- TP2 : Alignement par paires
- TP3 : Analyse de séquences et biologie Moléculaire
- TP4 : BLAST, alignement multiple, signature protéique
- TP5 : Revisions
Licence 3 Biologie des Organismes des populations et Ecosystemes (BOPE)
Du génome à la sélection des plantes (ELSVC5EM)
Initiation à la 'Bioanalyse'
Master
Master 1
Master 1 - Bioinformatique et Biologie des Systèmes + Biologie Végétale ADAM
Génomique Evolutive et Phylogénie
Supports de TD/TP :
- TP Adaptation Moleculaire
- Données pour le TP:
Medicago SNPs sequences Drosophile sequences Primates lysozymes sequences
Traitement de données biologiques (EMBIA1FM)
Supports de cours :
Supports de TD/TP :
- TP1 - Introduction à R
- TP2 - Régression linéaire, probabilités, intervalles de confiance
- TP3 - Tests statistiques - 1
- TP4 - Tests statistiques - 2 (ANOVA)
- TP5 - Analyse de transcriptome
- Archives
- Contrôle continu de 2011 avec son corrigé CC 2011 et correction.zip
Liens
- Documentation
- Aide mémoire des commandes R
- Aide mémoire pour RMarkdown disponible depuis http://rmarkdown.rstudio.com et http://rmarkdown.rstudio.com/lesson-1.html
- RMarkdown un peu plus détaillé disponible aussi sur la page citée à la ligne précédente
- http://www.rdocumentation.org/ Toute l'aide des librairies R (avec recherche)
- Sites dédiés
- Site de R : http://www.r-project.org et sites miroirs (dont ceux en France) pour télécharger le logiciel et les librairies : https://cran.r-project.org/mirrors.html
- RStudio : https://www.rstudio.com
- https://www.datacamp.com Apprendre R en ligne
- https://rdrr.io/snippets/ Utilisation de R depuis un navigateur
Génétique Evolutive et Quantitative (EMBIA1GM)
Support de cours:
- présentation de GEQ - M. Bonhomme
- introduction à GEQ - M. Bonhomme
- GE - Génétique des populations - M. Bonhomme
- GQ - Génétique-Quantitative - M. Bonhomme
- GQ - Cartographie génétique - M. Bonhomme
Supports de TD/TP :
- TD1 génétique des populations
- TP1 génétique des populations
- TD2 génétique quantitative
- TP2 génétique quantitative
- TD3 cartographie génétique
Master 1 - Bioinformatique et Biologie des Systèmes + Biotechnologies
Evolution Moléculaire (EMBIA2EM)
Supports de cours :
- Introduction à l'évolution moléculaire
- Evolution moléculaire : définitions
- Modèles évolutifs
- Méthodes de reconstructions phylogénétiques
- Méthodes de reconstructions phylogénétiques (suite)
- Adaptation moléculaire
Support TP :
- tutorial TP1 et TP2
- Petit topo d'introduction sur la régulation de la compétence chez S. pneumoniae
- Questionnaire sur l'analyse des arbres ComE et ComD
Support TD :
Exemple CC corrigé :
Master 1 - Bioinformatique et Biologie des Systèmes
Bioinformatique pour la Génomique (EMBIA1DM)
Supports de cours :
- Introduction biologique (Gwennaele Fichant)
- Annotation partie 1 (Gwennaele Fichant)
- Annotation partie 2 (Gwennaele Fichant)
- Définition et identification des motifs et profils dans les séquences (cours de L3 Bioanalyse) (Gwennaele Fichant)
- Modèle de Markov Caché (HMM) (Gwennaele Fichant)
- Introduction aux alignements de génomes bactériens (Gwennaele Fichant)
Tutoriels de TP :
- Annotation d'un fragment génomique bactérien
- design d'un HMM pour prédire les promoteurs sigma A de B. subtilis
Aide pour la réalisation du projet annotation
Contrôle continu :
- Rapport de TP sur le design d'un HMM à rendre au plus tard le lundi 14 octobre. M'envoyer par courrier le rapport en format pdf ainsi que le fichier en format texte comportant votre modèle avant estimation des probabilités.
- Projet annotation d'un fragment génomique à remettre au plus tard le lundi 9 décembre
- Description du travail à réaliser dans le fichier ci-joint : description du projet
- Description du travail à réaliser pour les parsers dans le fichier ci-joint : description des parsers
- Annoter une des deux séquences fournies : séquence 1 ou séquence 2
- Exemple d'annotation au format EMBL
Mathématique pour la Biologie (EMBIA1EM)
Sujets de TP :
Liens :
- http://exercism.io : améliorer son niveau de programmation dans différents langages (notamment R)
Références
- Mathématiques pour les Sciences de la vie et de la Terre – C. David, S. Mustapha, F. Viens, N. Capron, edition Dunod
Projet 2019-20 :
- Sujet du projet 2019-20
- Choix d'un graphe pour le projet (ne pas prendre un graphe déjà choisi par quelqu'un d'autre) : https://framadate.org/M1BBS-Projet-Math
- Les projets sont à rendre avant les fêtes de fin d'année
- Graphe à analyser
Traitement de graphes et réseaux biologiques (EMBIA1KM)
Supports de cours
Supports de TD/TP:
- TP1 Visualisation et exploration de graphes
- TP1-2-3-4 Librairie et parcours de graphes
- TP4 Librairies R
- TP5 Recherche de communautés dans les graphes
- TP archivé Dessin de graphes et initiation à la librairie iGraph
Projets 2019-20
Liens:
Logiciels
- Cytoscape (et Cytoscape Web mais un peu dépassé maintenant)
- Tulip librairie C/C++ pour le traitement et la visualisation de graphes
- Gephi
Librairies
- igraph R, python, ...
- NetworkX python
- graph-tool python
- Bioconductor/STRINGdb interface STRINGdb et R igraph
Serveurs & Banques
Formats
- Format GraphML http://graphml.graphdrawing.org/ et http://graphml.graphdrawing.org/primer/graphml-primer.html
Autres
- https://kateto.net/network-visualization Visu avec différents environnements et librairies
- Visualisation de l'algorithme Floyd-Warshall https://www.cs.usfca.edu/~galles/visualization/Floyd.html
- exercism.io : améliorer son niveau de programmation dans différents langages (notamment R)
- rosalind : apprentissage python en bioinformatique
Références
- Introduction to Algorithms, Corsen, Leiserson and Rivest, MIT Press and McGraw-Hill
- Detection of Functional Modules From Protein Interaction Networks, Pereira-Leal, Enright and Ozounis, PROTEINS: Structure, Function, and Bioinformatics, 49-57, 2004.
- An efficient algorithm for large-scale detection of protein families, Enright, Van Dongen and Ozounis, Nucleic Acids Research, 1575-84, 2002 PMID:11917018
- Kavosh: a new algorithm for finding network motifs, Kashani et al., BMC Bioinformatics, 2009. DOI:10.1186/1471-2105-10-318
- Pathway discovery in metabolic networks by subgraph extraction, Faust et al., Bioinformatics, 1211-1218, 2010. DOI:10.1093/bioinformatics/btq105
Fouille de données (EMBIA2DM)
Support de cours:
- Introduction et Généralités
- Classification, prédiction et caractérisation
- Clustering
- Règles d'association
Sujets de TD/TP
- TD Classification, validation croisée et clustering
Projet
Liens
- Data mining map
- http://www.kdnuggets.com/
- UCI KDD Archive (datasets)
- mloss (machine learning open source software) http://mloss.org
- Librairies et logiciels
- RapidMiner
- Knime
- weka
- Orange librairie python
- scikit-learn une autre librairie python
- Sequential Pattern Mining Framework open source Java implementation
Références
- Data Mining: Concepts and Techniques, J. Han and M. Kamber, 2006.
- GENECODIS: a web-based tool for finding significant concurrent annotations in gene lists, Carmona-Saez et al., Genome Biology, 2007.
- Petit cours d'autodéfense intellectuelle, Normand Baillargeon, 2006
Master 1 - MEEF
Sciences de la Vie (EE7BSVFM)
Supports de TD :
Master 2
Master 2P Diagnostic moléculaire en microbiolgy
Supports de cours
- Annotation génomes bactériens (Gwennaele Fichant)
- Définitions en phylogénie (Gwennaele Fichant)
- Introduction à la reconstruction phylogénétique (Gwennaele Fichant)
Tutoriels de TP
- Analyse évolutive de la cascade de régulation de la compétence chez les Streptocoques
- Petit topo d'introduction sur la régulation de la compétence chez S. pneumoniae
Master 2 - Bioinformatique et Biologie des Systèmes
Atelier système
Atelier Chipseq
Atelier Galaxy
UE Communication
liste des publications à présenter en préparation des ateliers:
Chaque publication sera choisie par deux étudiant(e)s. La présentation de la publication est personnelle. Donc chaque personne préparera une présentation powerpoint (ou pdf), diapositives en anglais, de 15 minutes qui sera suivie de 10 minutes de questions. La présentation et les questions se feront en français. Attention, ne pas oublier de consulter et de récupérer les supplementary data. La présentation devra faire ressortir la problématique abordée (question posée et contexte), la démarche bioinformatique adoptée, les résultats sous forme synthétisée avec choix pertinent des figures pour illustrer votre propos et la conclusion/discussion.
- Atelier Métabolomique
- Atelier ChipSeq
- Article 1 :
- Article 2 :
- Atelier Phylogénomique
- Article 1 :
- Article 2
- Atelier Modélisation
- Article 1 :
- Article 2 :
- A Quantitative Study of the Division Cycle of Caulobacter crescentus Stalked Cells
- Supplementary information à récupérer sur https://journals.plos.org/ploscompbiol/article?id=10.1371/journal.pcbi.0040009
Calendrier des présentations
EDT présentation des articles (les noms sont donnés pour rappel mais ordre de passage indifférent sauf Fulya 1ère) | ||||
---|---|---|---|---|
lundi 23 septembre 9h30-11h30 : | articles Atelier Métabolomique | article 1 : 9H30-11h00 (Juliette, Matthieu, Marine) | Commentaires : 11h-11h30 | |
lundi 23 septembre 13h30-16h : | articles Atelier Modélisation | article 1 : 13H30-14h30 (Alex, Soufiane) | article 2 : 14h30-15h30 (Eve, Clara) | Commentaires : 15h30-16h |
mardi 24 septembre 9h30-12h : | article Atelier Phylogénomique | article 2 : 9H30-10h30 (Tristan, Geoffrey) | article 1 : 10H30-11h30 (Elise, Chloé) | Commentaires : 11h30-12h |
mardi 24 septembre 14h-16h30 : | articles Atelier ChipSeq | article 1 : 14h-15h (Marion, Julien) | article 2 : 15h-16h (Nicolas, Cheryn) | Commentaires : 16h-16h30 |
Intégration de Données Hétérogènes - Partie R. Barriot
- Approches
- Enrichissement
- Fusion de données et priorisation de gènes candidats
- Mise en oeuvre
- Projets IDH
Atelier Génétique Satistique - S. Boitard
Support de cours et TD:
- Coalescence : principe et bases théoriques
- TD de génétique des populations
- TP : Diversité génétique d’une population structurée
- cours et TP de détection de locus sous sélection positive
TP :
- TP : simulations de données génétiques par coalescence fichier format pdf
- TP : simulations de données génétiques par coalescence fichier format html
- TP estimation de paramètres par une approche ABC
Atelier Phylogénomique
Intervenants : Hélène Chiapello, Claire Hoede et Yves Quentin
Biologie des Systèmes - R. Barriot
Biologie des Systèmes - G. Czaplicki
Fichiers avec les codes :
Biologie des Systèmes - G. Fichant
Support de cours:
- Introduction to system biology
- Petit rappel enzymologie
- Complément rappel enzymologie
- Introduction to Petri net models
- Introduction to stochastic simulation
- Introduction parameter estimation
- Introduction to Piece-wise linear differential equation models
- System dynamic analyses
TP :
- Copasi user guide
- Lien vers le site de Snoopy : https://www-dssz.informatik.tu-cottbus.de/DSSZ/Software/Snoopy
- TP1 : modeling of the psp response when cell envelop is damaged
- TP2 : modeling of the repressilator:
- TP3 : modeling phosphate regulation in enterobacteria:
- TP4 : modeling of the regulation of lactose operon :
Master 2 - ADAM (Adaptation, Développement et Amélioration des plantes en présence de Microorganismes)
Biologie Computationnelle
Documents, partie E. Gaulin
Culture
- Une histoire de tout ou presque... Bill Bryson, Payot, coll. "Petite Bibliothèque Payot" n° 851, 2012 (ISBN: 9782228907576)
- Norman Baillargeon - Petit cours d'autodéfense intellectuelle, Éditions Lux, collection Instinct de Liberté, 2005. (ISBN: 2-895960-44-5)
- Faire l'économie de la haine, Alain Deneault, 2018, Ecosociete Eds, coll. Polemos
- Comment tout peut s'effondrer. Petit manuel de collapsologie à l'usage des générations présentes. 2015. Pablo Servigne, :Raphaël Stevens. seuil
- Les sentiers de l'utopie, I. Fremeaux et J. Jordan, 2012.
F.A.Q.
- Caractérisation d'un ensemble de gènes d'intérêt. Soit qu'ils sont différentiellement exprimés, soit qu'ils sont co-exprimés.
- Installation de igraph sur CentOS 6.7 en P0
Sous R, l'installation d'igraph échoue avec le protocole https, il faut donc choisir un mirroir avec le protocol http : choseCRANmirror() dernier choix (http mirrors) puis Lyon2
R> chooseCRANmirror() R> install.packages('igraph')
- Installation de Rstudio sur CentOS 6.7 en P0
La dernière version de Rstudio desktop ne fonctionne pas pour CentOS6.7 (nécessite des librairies plus récentes). Il faut donc télécharger et installer la version serveur :
# Dans un terminal, passer root (super-utilisateur) bash> su # puis les commandes ci-dessous (sans le "root>") root> wget https://download2.rstudio.org/rstudio-server-rhel-0.99.892-x86_64.rpm root> yum install --nogpgcheck rstudio-server-rhel-0.99.892-x86_64.rpm
Ensuite, on accède à l'interface avec le navigateur : http://localhost:8787 avec un compte de la machine (normalement le compte guest)